Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625283_at:

>probe:Drosophila_2:1625283_at:53:89; Interrogation_Position=1429; Antisense; AGTCTTGCTGCTCATAGACGTCCGA
>probe:Drosophila_2:1625283_at:698:407; Interrogation_Position=1445; Antisense; GACGTCCGAGGCTAATCATTGCCAA
>probe:Drosophila_2:1625283_at:215:625; Interrogation_Position=1464; Antisense; TGCCAACAAGCACTTTATCGTCCAC
>probe:Drosophila_2:1625283_at:59:685; Interrogation_Position=1479; Antisense; TATCGTCCACCGTATTTTGGGCAAG
>probe:Drosophila_2:1625283_at:73:73; Interrogation_Position=1502; Antisense; AGGACAACCTTATCGGATCCTGGCG
>probe:Drosophila_2:1625283_at:495:449; Interrogation_Position=1517; Antisense; GATCCTGGCGTTGCATGTATCATCA
>probe:Drosophila_2:1625283_at:666:145; Interrogation_Position=1564; Antisense; ACTACGTTCATGGTGGACTCCGAGG
>probe:Drosophila_2:1625283_at:611:511; Interrogation_Position=1588; Antisense; GTGAAATACCGCAGCACGTGCTCAT
>probe:Drosophila_2:1625283_at:633:507; Interrogation_Position=1605; Antisense; GTGCTCATCGCACAACCACAAAAAT
>probe:Drosophila_2:1625283_at:257:85; Interrogation_Position=1655; Antisense; AGATGCCTTGGGTCTTTACCGACTA
>probe:Drosophila_2:1625283_at:500:179; Interrogation_Position=1685; Antisense; AAAAAGGGTCCTGTTCTCATCGTCA
>probe:Drosophila_2:1625283_at:566:471; Interrogation_Position=1697; Antisense; GTTCTCATCGTCAAGTACATTCCAA
>probe:Drosophila_2:1625283_at:673:397; Interrogation_Position=1744; Antisense; GACACAGCTTCTTCTAATTGTTCGT
>probe:Drosophila_2:1625283_at:322:485; Interrogation_Position=1767; Antisense; GTAGATATTTACCAGCGAACGAGAT

Paste this into a BLAST search page for me
AGTCTTGCTGCTCATAGACGTCCGAGACGTCCGAGGCTAATCATTGCCAATGCCAACAAGCACTTTATCGTCCACTATCGTCCACCGTATTTTGGGCAAGAGGACAACCTTATCGGATCCTGGCGGATCCTGGCGTTGCATGTATCATCAACTACGTTCATGGTGGACTCCGAGGGTGAAATACCGCAGCACGTGCTCATGTGCTCATCGCACAACCACAAAAATAGATGCCTTGGGTCTTTACCGACTAAAAAAGGGTCCTGTTCTCATCGTCAGTTCTCATCGTCAAGTACATTCCAAGACACAGCTTCTTCTAATTGTTCGTGTAGATATTTACCAGCGAACGAGAT

Full Affymetrix probeset data:

Annotations for 1625283_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime