Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625284_at:

>probe:Drosophila_2:1625284_at:488:179; Interrogation_Position=1602; Antisense; AAACTTATTATTACCATGCTGCCGC
>probe:Drosophila_2:1625284_at:726:625; Interrogation_Position=1621; Antisense; TGCCGCACCACTTGATGAGACTTAA
>probe:Drosophila_2:1625284_at:619:17; Interrogation_Position=1680; Antisense; ATTTCGCAGTTCTACCGGGCAATGA
>probe:Drosophila_2:1625284_at:416:11; Interrogation_Position=1710; Antisense; ATTACCCAGTGGCTCCTATTTCTAT
>probe:Drosophila_2:1625284_at:70:629; Interrogation_Position=1723; Antisense; TCCTATTTCTATACGAGTCCTACTC
>probe:Drosophila_2:1625284_at:353:549; Interrogation_Position=1767; Antisense; GGAGGACTCTTTTCCGCAATGTACC
>probe:Drosophila_2:1625284_at:584:173; Interrogation_Position=1839; Antisense; AAAGCCATTGACTCTGAGCGGCCGC
>probe:Drosophila_2:1625284_at:173:87; Interrogation_Position=1942; Antisense; AGTGCGGCCACATTTTCTGTGATGA
>probe:Drosophila_2:1625284_at:664:103; Interrogation_Position=1996; Antisense; AGACCTGTCCGATGTGCAGGGCGAA
>probe:Drosophila_2:1625284_at:84:373; Interrogation_Position=2018; Antisense; GAAGGTTAGCGATGATCCCGCCTGG
>probe:Drosophila_2:1625284_at:314:673; Interrogation_Position=2057; Antisense; TACCTTCTTCCATCAGTTGTACTAG
>probe:Drosophila_2:1625284_at:409:467; Interrogation_Position=2072; Antisense; GTTGTACTAGCTGCGCCACCAAAGA
>probe:Drosophila_2:1625284_at:85:395; Interrogation_Position=2095; Antisense; GAAATTTCCACGGATTTCGCGTGTA
>probe:Drosophila_2:1625284_at:621:297; Interrogation_Position=2128; Antisense; CGCTAGCTAGCCCTTTGTTTAATTA

Paste this into a BLAST search page for me
AAACTTATTATTACCATGCTGCCGCTGCCGCACCACTTGATGAGACTTAAATTTCGCAGTTCTACCGGGCAATGAATTACCCAGTGGCTCCTATTTCTATTCCTATTTCTATACGAGTCCTACTCGGAGGACTCTTTTCCGCAATGTACCAAAGCCATTGACTCTGAGCGGCCGCAGTGCGGCCACATTTTCTGTGATGAAGACCTGTCCGATGTGCAGGGCGAAGAAGGTTAGCGATGATCCCGCCTGGTACCTTCTTCCATCAGTTGTACTAGGTTGTACTAGCTGCGCCACCAAAGAGAAATTTCCACGGATTTCGCGTGTACGCTAGCTAGCCCTTTGTTTAATTA

Full Affymetrix probeset data:

Annotations for 1625284_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime