FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625288_at:

>probe:Drosophila_2:1625288_at:530:413; Interrogation_Position=111; Antisense; GACCAGTCTGCTCGTGCTGAAGATG
>probe:Drosophila_2:1625288_at:45:97; Interrogation_Position=131; Antisense; AGATGCTCGTTATGTCACTACTCAC
>probe:Drosophila_2:1625288_at:139:397; Interrogation_Position=16; Antisense; GACAACGGACCGATGGATGCCACGC
>probe:Drosophila_2:1625288_at:73:103; Interrogation_Position=179; Antisense; AGACCTATGCCAACCCAGAGGATTT
>probe:Drosophila_2:1625288_at:606:17; Interrogation_Position=200; Antisense; ATTTACGCCTGAGTCGGAGCACGGA
>probe:Drosophila_2:1625288_at:114:199; Interrogation_Position=251; Antisense; AACGAGTTCGTCGTGCTCATCGCAA
>probe:Drosophila_2:1625288_at:648:647; Interrogation_Position=267; Antisense; TCATCGCAACGACCTAGAGAACATT
>probe:Drosophila_2:1625288_at:154:93; Interrogation_Position=282; Antisense; AGAGAACATTTTGCCCTTTCTTCTG
>probe:Drosophila_2:1625288_at:593:697; Interrogation_Position=298; Antisense; TTTCTTCTGATGTCGCTGGCCTATG
>probe:Drosophila_2:1625288_at:363:507; Interrogation_Position=487; Antisense; GTGCTCGTCTGCTGTATCAAGTACA
>probe:Drosophila_2:1625288_at:559:307; Interrogation_Position=53; Antisense; CCTTCCGGCTGATTTTGCTTAGCAA
>probe:Drosophila_2:1625288_at:417:693; Interrogation_Position=66; Antisense; TTTGCTTAGCAAATCGAATCCCGTG
>probe:Drosophila_2:1625288_at:523:297; Interrogation_Position=80; Antisense; CGAATCCCGTGATGGGTTGCTACAT
>probe:Drosophila_2:1625288_at:356:469; Interrogation_Position=95; Antisense; GTTGCTACATGTTCTGGACCAGTCT

Paste this into a BLAST search page for me
GACCAGTCTGCTCGTGCTGAAGATGAGATGCTCGTTATGTCACTACTCACGACAACGGACCGATGGATGCCACGCAGACCTATGCCAACCCAGAGGATTTATTTACGCCTGAGTCGGAGCACGGAAACGAGTTCGTCGTGCTCATCGCAATCATCGCAACGACCTAGAGAACATTAGAGAACATTTTGCCCTTTCTTCTGTTTCTTCTGATGTCGCTGGCCTATGGTGCTCGTCTGCTGTATCAAGTACACCTTCCGGCTGATTTTGCTTAGCAATTTGCTTAGCAAATCGAATCCCGTGCGAATCCCGTGATGGGTTGCTACATGTTGCTACATGTTCTGGACCAGTCT

Full Affymetrix probeset data:

Annotations for 1625288_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720