FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625290_at:

>probe:Drosophila_2:1625290_at:213:461; Interrogation_Position=315; Antisense; GATTTTCTTGGCGACATTGATACTA
>probe:Drosophila_2:1625290_at:51:353; Interrogation_Position=381; Antisense; GCAGCAAGTGCTACCAATACCAATA
>probe:Drosophila_2:1625290_at:378:241; Interrogation_Position=396; Antisense; AATACCAATACGCATGAGACTTGTA
>probe:Drosophila_2:1625290_at:290:195; Interrogation_Position=455; Antisense; AACTGCACAGCAATACGATTCCAAA
>probe:Drosophila_2:1625290_at:221:463; Interrogation_Position=471; Antisense; GATTCCAAAAGAACCACGCTTTCAG
>probe:Drosophila_2:1625290_at:615:133; Interrogation_Position=486; Antisense; ACGCTTTCAGTTTCCACACTCGGAA
>probe:Drosophila_2:1625290_at:190:105; Interrogation_Position=638; Antisense; AGACGAACTTCTGTGCTCGCATAAC
>probe:Drosophila_2:1625290_at:154:699; Interrogation_Position=681; Antisense; TTGGACCGTCAAGACTTTTTGGAGA
>probe:Drosophila_2:1625290_at:22:551; Interrogation_Position=701; Antisense; GGAGAGAACCGATCTTAGGCAGTTT
>probe:Drosophila_2:1625290_at:530:109; Interrogation_Position=736; Antisense; AGAAGTTGCGGCTGTCTCGCAGGCC
>probe:Drosophila_2:1625290_at:251:281; Interrogation_Position=751; Antisense; CTCGCAGGCCATACTAACGGCTTAA
>probe:Drosophila_2:1625290_at:88:571; Interrogation_Position=769; Antisense; GGCTTAACCAACGTCGACACGGTAG
>probe:Drosophila_2:1625290_at:365:141; Interrogation_Position=787; Antisense; ACGGTAGCGCTGACTTCTTTGAATA
>probe:Drosophila_2:1625290_at:483:531; Interrogation_Position=878; Antisense; GGTTGGGCTTACACCAATTCAATCA

Paste this into a BLAST search page for me
GATTTTCTTGGCGACATTGATACTAGCAGCAAGTGCTACCAATACCAATAAATACCAATACGCATGAGACTTGTAAACTGCACAGCAATACGATTCCAAAGATTCCAAAAGAACCACGCTTTCAGACGCTTTCAGTTTCCACACTCGGAAAGACGAACTTCTGTGCTCGCATAACTTGGACCGTCAAGACTTTTTGGAGAGGAGAGAACCGATCTTAGGCAGTTTAGAAGTTGCGGCTGTCTCGCAGGCCCTCGCAGGCCATACTAACGGCTTAAGGCTTAACCAACGTCGACACGGTAGACGGTAGCGCTGACTTCTTTGAATAGGTTGGGCTTACACCAATTCAATCA

Full Affymetrix probeset data:

Annotations for 1625290_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720