FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625292_at:

>probe:Drosophila_2:1625292_at:106:125; Interrogation_Position=372; Antisense; AGCGCCAGCTGGAGGGCTTTTGCAA
>probe:Drosophila_2:1625292_at:436:367; Interrogation_Position=441; Antisense; GAATCGCTGAATTGCGCACCTACAT
>probe:Drosophila_2:1625292_at:59:131; Interrogation_Position=458; Antisense; ACCTACATCGCTTACCACGAGAATG
>probe:Drosophila_2:1625292_at:422:425; Interrogation_Position=518; Antisense; GAGAGATTCCATACGCCGGAGTTCA
>probe:Drosophila_2:1625292_at:723:223; Interrogation_Position=542; Antisense; AAGGAGGCCTGGAACACCTCTATCA
>probe:Drosophila_2:1625292_at:223:131; Interrogation_Position=557; Antisense; ACCTCTATCAGCACTTCGGACAAAT
>probe:Drosophila_2:1625292_at:360:275; Interrogation_Position=570; Antisense; CTTCGGACAAATCGCCGTCGGATAT
>probe:Drosophila_2:1625292_at:28:501; Interrogation_Position=586; Antisense; GTCGGATATGCCTTCTGATAGCTCC
>probe:Drosophila_2:1625292_at:579:149; Interrogation_Position=624; Antisense; ACTTGGATACCCAGTCAACGCGGAG
>probe:Drosophila_2:1625292_at:220:423; Interrogation_Position=646; Antisense; GAGAAGATCTTTTGGCAGCGACACT
>probe:Drosophila_2:1625292_at:72:227; Interrogation_Position=672; Antisense; AAGGCTTTCGTCTTTAGTCACTCCA
>probe:Drosophila_2:1625292_at:434:413; Interrogation_Position=764; Antisense; GACCTTCCAGAAGATTCCCAATATA
>probe:Drosophila_2:1625292_at:489:13; Interrogation_Position=857; Antisense; ATTCAAATCGAGACGTTCCACTACT
>probe:Drosophila_2:1625292_at:246:469; Interrogation_Position=871; Antisense; GTTCCACTACTCATGTGCGGGATAT

Paste this into a BLAST search page for me
AGCGCCAGCTGGAGGGCTTTTGCAAGAATCGCTGAATTGCGCACCTACATACCTACATCGCTTACCACGAGAATGGAGAGATTCCATACGCCGGAGTTCAAAGGAGGCCTGGAACACCTCTATCAACCTCTATCAGCACTTCGGACAAATCTTCGGACAAATCGCCGTCGGATATGTCGGATATGCCTTCTGATAGCTCCACTTGGATACCCAGTCAACGCGGAGGAGAAGATCTTTTGGCAGCGACACTAAGGCTTTCGTCTTTAGTCACTCCAGACCTTCCAGAAGATTCCCAATATAATTCAAATCGAGACGTTCCACTACTGTTCCACTACTCATGTGCGGGATAT

Full Affymetrix probeset data:

Annotations for 1625292_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720