FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625294_at:

>probe:Drosophila_2:1625294_at:182:161; Interrogation_Position=121; Antisense; ACAACCTCAACTTCTGCTTCGGCTA
>probe:Drosophila_2:1625294_at:348:127; Interrogation_Position=175; Antisense; ACCACTGCGTCGGATACAACTACTA
>probe:Drosophila_2:1625294_at:578:637; Interrogation_Position=223; Antisense; TCGTCCTCCTCCTCAAAGAGTAAAA
>probe:Drosophila_2:1625294_at:343:661; Interrogation_Position=270; Antisense; TACACGTCATGTTTATAGGCCAAAG
>probe:Drosophila_2:1625294_at:281:679; Interrogation_Position=285; Antisense; TAGGCCAAAGCGGATACGACATATC
>probe:Drosophila_2:1625294_at:186:297; Interrogation_Position=301; Antisense; CGACATATCTATAGGCACAAGGCCG
>probe:Drosophila_2:1625294_at:330:227; Interrogation_Position=319; Antisense; AAGGCCGACGACGACGAAAGCTCTA
>probe:Drosophila_2:1625294_at:308:51; Interrogation_Position=40; Antisense; ATGCGCTACTCCTGTGTTCTTTTAC
>probe:Drosophila_2:1625294_at:447:487; Interrogation_Position=416; Antisense; GTAGCCGCAGTGGTAACAGTCGCAT
>probe:Drosophila_2:1625294_at:506:45; Interrogation_Position=439; Antisense; ATCCGCCGCAGGAGAGCCCGAAGTG
>probe:Drosophila_2:1625294_at:192:317; Interrogation_Position=470; Antisense; GCCTGTCTTAGTGACCACATCTTGT
>probe:Drosophila_2:1625294_at:521:193; Interrogation_Position=505; Antisense; AACTGATCTGATCGTGACGCCTTTG
>probe:Drosophila_2:1625294_at:219:603; Interrogation_Position=54; Antisense; TGTTCTTTTACTTCTGGCCACCGTT
>probe:Drosophila_2:1625294_at:373:469; Interrogation_Position=76; Antisense; GTTGCCTGTCTGCTAATCCCACAGA

Paste this into a BLAST search page for me
ACAACCTCAACTTCTGCTTCGGCTAACCACTGCGTCGGATACAACTACTATCGTCCTCCTCCTCAAAGAGTAAAATACACGTCATGTTTATAGGCCAAAGTAGGCCAAAGCGGATACGACATATCCGACATATCTATAGGCACAAGGCCGAAGGCCGACGACGACGAAAGCTCTAATGCGCTACTCCTGTGTTCTTTTACGTAGCCGCAGTGGTAACAGTCGCATATCCGCCGCAGGAGAGCCCGAAGTGGCCTGTCTTAGTGACCACATCTTGTAACTGATCTGATCGTGACGCCTTTGTGTTCTTTTACTTCTGGCCACCGTTGTTGCCTGTCTGCTAATCCCACAGA

Full Affymetrix probeset data:

Annotations for 1625294_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720