Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625295_at:

>probe:Drosophila_2:1625295_at:373:715; Interrogation_Position=3156; Antisense; TTCTGAGGGAACTGCAGCATGGCCA
>probe:Drosophila_2:1625295_at:298:69; Interrogation_Position=3174; Antisense; ATGGCCACTGTCACTGTCTAGTACA
>probe:Drosophila_2:1625295_at:130:497; Interrogation_Position=3189; Antisense; GTCTAGTACAATTTCGATCTACCAA
>probe:Drosophila_2:1625295_at:248:453; Interrogation_Position=3204; Antisense; GATCTACCAACTAAGCTAGCTCGCT
>probe:Drosophila_2:1625295_at:203:209; Interrogation_Position=3216; Antisense; AAGCTAGCTCGCTTTGTGCCCTCGT
>probe:Drosophila_2:1625295_at:197:179; Interrogation_Position=3252; Antisense; AAACTCTCTCCCAAGGCGAAGTTCT
>probe:Drosophila_2:1625295_at:678:323; Interrogation_Position=3267; Antisense; GCGAAGTTCTATCGAGCCGAGCGAA
>probe:Drosophila_2:1625295_at:550:295; Interrogation_Position=3279; Antisense; CGAGCCGAGCGAAGATTGTAAATAC
>probe:Drosophila_2:1625295_at:15:601; Interrogation_Position=3357; Antisense; TGTAGGCATGTATCGGGAGCACTCC
>probe:Drosophila_2:1625295_at:60:639; Interrogation_Position=3369; Antisense; TCGGGAGCACTCCAGTTGCAGTTGT
>probe:Drosophila_2:1625295_at:57:189; Interrogation_Position=3469; Antisense; AACAGAGAAGGCATAGACATACATA
>probe:Drosophila_2:1625295_at:5:253; Interrogation_Position=3508; Antisense; CAAGCACTGTGGCAAACATAAATGT
>probe:Drosophila_2:1625295_at:474:195; Interrogation_Position=3534; Antisense; AACGTTAATCAGGTGAGCAATTTCT
>probe:Drosophila_2:1625295_at:700:359; Interrogation_Position=3646; Antisense; GCAATGTATTGTATATGACGGACTA

Paste this into a BLAST search page for me
TTCTGAGGGAACTGCAGCATGGCCAATGGCCACTGTCACTGTCTAGTACAGTCTAGTACAATTTCGATCTACCAAGATCTACCAACTAAGCTAGCTCGCTAAGCTAGCTCGCTTTGTGCCCTCGTAAACTCTCTCCCAAGGCGAAGTTCTGCGAAGTTCTATCGAGCCGAGCGAACGAGCCGAGCGAAGATTGTAAATACTGTAGGCATGTATCGGGAGCACTCCTCGGGAGCACTCCAGTTGCAGTTGTAACAGAGAAGGCATAGACATACATACAAGCACTGTGGCAAACATAAATGTAACGTTAATCAGGTGAGCAATTTCTGCAATGTATTGTATATGACGGACTA

Full Affymetrix probeset data:

Annotations for 1625295_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime