FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625296_at:

>probe:Drosophila_2:1625296_at:215:153; Interrogation_Position=275; Antisense; ACATCCTATTCCACAGAAGCCTTCA
>probe:Drosophila_2:1625296_at:332:7; Interrogation_Position=299; Antisense; ATTGCCTCCTGCAGGGTCGAATGGG
>probe:Drosophila_2:1625296_at:502:559; Interrogation_Position=349; Antisense; GGAAATGGGCGTGCCTCGGTCCATT
>probe:Drosophila_2:1625296_at:328:639; Interrogation_Position=364; Antisense; TCGGTCCATTCGCATAAATCAGTTT
>probe:Drosophila_2:1625296_at:162:365; Interrogation_Position=458; Antisense; GAATCAGCAGGCAGTCCGTGCAACA
>probe:Drosophila_2:1625296_at:89:503; Interrogation_Position=471; Antisense; GTCCGTGCAACAGTTTGGGCCCAAA
>probe:Drosophila_2:1625296_at:646:181; Interrogation_Position=494; Antisense; AAAACTTTTGCCACATCAGCGTGTG
>probe:Drosophila_2:1625296_at:589:31; Interrogation_Position=560; Antisense; ATAACGTGCGTGAGTATGAGTGCCG
>probe:Drosophila_2:1625296_at:705:661; Interrogation_Position=656; Antisense; TAACAGTTACAGTCGCTCTGGTCAC
>probe:Drosophila_2:1625296_at:289:495; Interrogation_Position=676; Antisense; GTCACGCCGCATCAAATGGCCAAGA
>probe:Drosophila_2:1625296_at:447:311; Interrogation_Position=694; Antisense; GCCAAGACGCGTGCTGCGTGTTATA
>probe:Drosophila_2:1625296_at:26:57; Interrogation_Position=718; Antisense; ATGAGCATTTTACAGCACCGACGCC
>probe:Drosophila_2:1625296_at:231:389; Interrogation_Position=793; Antisense; GAAACAATTGTCTCTTCGAAGCTTT
>probe:Drosophila_2:1625296_at:720:275; Interrogation_Position=805; Antisense; TCTTCGAAGCTTTTCAGGCCGGTTT

Paste this into a BLAST search page for me
ACATCCTATTCCACAGAAGCCTTCAATTGCCTCCTGCAGGGTCGAATGGGGGAAATGGGCGTGCCTCGGTCCATTTCGGTCCATTCGCATAAATCAGTTTGAATCAGCAGGCAGTCCGTGCAACAGTCCGTGCAACAGTTTGGGCCCAAAAAAACTTTTGCCACATCAGCGTGTGATAACGTGCGTGAGTATGAGTGCCGTAACAGTTACAGTCGCTCTGGTCACGTCACGCCGCATCAAATGGCCAAGAGCCAAGACGCGTGCTGCGTGTTATAATGAGCATTTTACAGCACCGACGCCGAAACAATTGTCTCTTCGAAGCTTTTCTTCGAAGCTTTTCAGGCCGGTTT

Full Affymetrix probeset data:

Annotations for 1625296_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720