FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625297_at:

>probe:Drosophila_2:1625297_at:539:549; Interrogation_Position=1005; Antisense; GGAGACGGGAATCCGCACCGAATTC
>probe:Drosophila_2:1625297_at:313:363; Interrogation_Position=1024; Antisense; GAATTCCGCTCAGTGGTCAGTCTGC
>probe:Drosophila_2:1625297_at:329:401; Interrogation_Position=1081; Antisense; GACATGTACGTGGTCATCGCCCTAA
>probe:Drosophila_2:1625297_at:175:259; Interrogation_Position=1095; Antisense; CATCGCCCTAAAGCCACTGAATTTG
>probe:Drosophila_2:1625297_at:37:145; Interrogation_Position=1110; Antisense; ACTGAATTTGGACTTTACGCGCTGC
>probe:Drosophila_2:1625297_at:55:51; Interrogation_Position=1162; Antisense; ATGCCCATCGCGGAGTATCTGAAGC
>probe:Drosophila_2:1625297_at:576:91; Interrogation_Position=1175; Antisense; AGTATCTGAAGCATCCGCAGGTCCA
>probe:Drosophila_2:1625297_at:646:535; Interrogation_Position=1194; Antisense; GGTCCACGAGACGAACAGGCAGTTC
>probe:Drosophila_2:1625297_at:339:93; Interrogation_Position=1214; Antisense; AGTTCGTCTGCACCTTTTTGGACTA
>probe:Drosophila_2:1625297_at:642:597; Interrogation_Position=1264; Antisense; TGTCGCGACGAAGTGCATCAGGTGC
>probe:Drosophila_2:1625297_at:506:423; Interrogation_Position=1361; Antisense; GAGACTTGTCGGTGCAATGGCCAAA
>probe:Drosophila_2:1625297_at:346:251; Interrogation_Position=1375; Antisense; CAATGGCCAAATCCTTAGTGCAATT
>probe:Drosophila_2:1625297_at:174:217; Interrogation_Position=1406; Antisense; AAGTCCTTTCTTCCAAAAGCCAGCA
>probe:Drosophila_2:1625297_at:673:527; Interrogation_Position=965; Antisense; GGGAGAATCTCATCGATGCGGCAAT

Paste this into a BLAST search page for me
GGAGACGGGAATCCGCACCGAATTCGAATTCCGCTCAGTGGTCAGTCTGCGACATGTACGTGGTCATCGCCCTAACATCGCCCTAAAGCCACTGAATTTGACTGAATTTGGACTTTACGCGCTGCATGCCCATCGCGGAGTATCTGAAGCAGTATCTGAAGCATCCGCAGGTCCAGGTCCACGAGACGAACAGGCAGTTCAGTTCGTCTGCACCTTTTTGGACTATGTCGCGACGAAGTGCATCAGGTGCGAGACTTGTCGGTGCAATGGCCAAACAATGGCCAAATCCTTAGTGCAATTAAGTCCTTTCTTCCAAAAGCCAGCAGGGAGAATCTCATCGATGCGGCAAT

Full Affymetrix probeset data:

Annotations for 1625297_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720