FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625301_at:

>probe:Drosophila_2:1625301_at:108:145; Interrogation_Position=118; Antisense; ACTGCAGCCGCCAATGGTGGTGGCA
>probe:Drosophila_2:1625301_at:43:239; Interrogation_Position=148; Antisense; AATCTGAACATCAATCTTCCGGAGA
>probe:Drosophila_2:1625301_at:84:211; Interrogation_Position=214; Antisense; AAGAATGTGCCCAAGTATCGTCGTG
>probe:Drosophila_2:1625301_at:114:197; Interrogation_Position=336; Antisense; AACGGGCACCGGAGTCCAGATTTTG
>probe:Drosophila_2:1625301_at:472:95; Interrogation_Position=353; Antisense; AGATTTTGCCAGCTGACACCTCAAC
>probe:Drosophila_2:1625301_at:140:131; Interrogation_Position=370; Antisense; ACCTCAACGGTGGTGGGTGCTCCCA
>probe:Drosophila_2:1625301_at:112:533; Interrogation_Position=384; Antisense; GGGTGCTCCCATGGACAAACGTAAT
>probe:Drosophila_2:1625301_at:283:293; Interrogation_Position=403; Antisense; CGTAATTTAGTGGTGCCGCTCGAAA
>probe:Drosophila_2:1625301_at:596:419; Interrogation_Position=463; Antisense; GAGCACGTTACTTGGACGACCAGCA
>probe:Drosophila_2:1625301_at:261:79; Interrogation_Position=491; Antisense; AGGGATATTTCCATCACGTCGTTTT
>probe:Drosophila_2:1625301_at:570:141; Interrogation_Position=562; Antisense; ACGGAACTGGGCATTGGCACTAAAT
>probe:Drosophila_2:1625301_at:436:9; Interrogation_Position=590; Antisense; ATTCCAGTGTCAGGAGCTGCTGCGA
>probe:Drosophila_2:1625301_at:600:73; Interrogation_Position=633; Antisense; AGGAACTAGCCCCAGCAAGGAGCAA
>probe:Drosophila_2:1625301_at:188:47; Interrogation_Position=673; Antisense; ATCCGTGGTCCATCTGGTGGTGCAT

Paste this into a BLAST search page for me
ACTGCAGCCGCCAATGGTGGTGGCAAATCTGAACATCAATCTTCCGGAGAAAGAATGTGCCCAAGTATCGTCGTGAACGGGCACCGGAGTCCAGATTTTGAGATTTTGCCAGCTGACACCTCAACACCTCAACGGTGGTGGGTGCTCCCAGGGTGCTCCCATGGACAAACGTAATCGTAATTTAGTGGTGCCGCTCGAAAGAGCACGTTACTTGGACGACCAGCAAGGGATATTTCCATCACGTCGTTTTACGGAACTGGGCATTGGCACTAAATATTCCAGTGTCAGGAGCTGCTGCGAAGGAACTAGCCCCAGCAAGGAGCAAATCCGTGGTCCATCTGGTGGTGCAT

Full Affymetrix probeset data:

Annotations for 1625301_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720