FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625302_at:

>probe:Drosophila_2:1625302_at:424:535; Interrogation_Position=1023; Antisense; GGTGCCCATGCAGGATTTGAACTAC
>probe:Drosophila_2:1625302_at:67:671; Interrogation_Position=1045; Antisense; TACGACTACGATACGCAGAGCCTGC
>probe:Drosophila_2:1625302_at:276:41; Interrogation_Position=1082; Antisense; ATCGTGGAACCATGGACAGCAGCTA
>probe:Drosophila_2:1625302_at:125:155; Interrogation_Position=1097; Antisense; ACAGCAGCTACATGGGCGTGGACAT
>probe:Drosophila_2:1625302_at:418:469; Interrogation_Position=1167; Antisense; GTTGCTCAAGCGCAATGTCTCACTG
>probe:Drosophila_2:1625302_at:212:61; Interrogation_Position=1181; Antisense; ATGTCTCACTGCTGTCCATACGCAT
>probe:Drosophila_2:1625302_at:421:241; Interrogation_Position=638; Antisense; AATACGTGATGTTCGCACTGATATT
>probe:Drosophila_2:1625302_at:491:689; Interrogation_Position=659; Antisense; TATTTATACTATTTGGCCTGGCCAT
>probe:Drosophila_2:1625302_at:26:297; Interrogation_Position=690; Antisense; CGCCTCGCTGAACTTGTTAGTACTT
>probe:Drosophila_2:1625302_at:621:195; Interrogation_Position=817; Antisense; AACGGATCCATTCTGAGCGGCTACG
>probe:Drosophila_2:1625302_at:688:339; Interrogation_Position=836; Antisense; GCTACGAGGGACACGATGGCCAATC
>probe:Drosophila_2:1625302_at:49:441; Interrogation_Position=850; Antisense; GATGGCCAATCTCTGAACGGAAGCA
>probe:Drosophila_2:1625302_at:241:439; Interrogation_Position=981; Antisense; GAGGCAATCGCCGACGCACATACGA
>probe:Drosophila_2:1625302_at:331:151; Interrogation_Position=998; Antisense; ACATACGACACCTTCTGCCGGAGGT

Paste this into a BLAST search page for me
GGTGCCCATGCAGGATTTGAACTACTACGACTACGATACGCAGAGCCTGCATCGTGGAACCATGGACAGCAGCTAACAGCAGCTACATGGGCGTGGACATGTTGCTCAAGCGCAATGTCTCACTGATGTCTCACTGCTGTCCATACGCATAATACGTGATGTTCGCACTGATATTTATTTATACTATTTGGCCTGGCCATCGCCTCGCTGAACTTGTTAGTACTTAACGGATCCATTCTGAGCGGCTACGGCTACGAGGGACACGATGGCCAATCGATGGCCAATCTCTGAACGGAAGCAGAGGCAATCGCCGACGCACATACGAACATACGACACCTTCTGCCGGAGGT

Full Affymetrix probeset data:

Annotations for 1625302_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720