FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625303_at:

>probe:Drosophila_2:1625303_at:72:515; Interrogation_Position=1008; Antisense; GTGTATTGTCTTGATTTATTTGGCT
>probe:Drosophila_2:1625303_at:436:689; Interrogation_Position=1011; Antisense; TATTGTCTTGATTTATTTGGCTTAA
>probe:Drosophila_2:1625303_at:268:295; Interrogation_Position=891; Antisense; CGATGGTCCAAAACAAGATGCATAT
>probe:Drosophila_2:1625303_at:186:187; Interrogation_Position=902; Antisense; AACAAGATGCATATGCGGCCAGGGA
>probe:Drosophila_2:1625303_at:616:251; Interrogation_Position=904; Antisense; CAAGATGCATATGCGGCCAGGGAAT
>probe:Drosophila_2:1625303_at:120:683; Interrogation_Position=913; Antisense; TATGCGGCCAGGGAATACGTGCTAC
>probe:Drosophila_2:1625303_at:340:327; Interrogation_Position=916; Antisense; GCGGCCAGGGAATACGTGCTACGTA
>probe:Drosophila_2:1625303_at:227:669; Interrogation_Position=928; Antisense; TACGTGCTACGTATGTTTCAAAGCA
>probe:Drosophila_2:1625303_at:629:339; Interrogation_Position=933; Antisense; GCTACGTATGTTTCAAAGCATTAGT
>probe:Drosophila_2:1625303_at:629:483; Interrogation_Position=938; Antisense; GTATGTTTCAAAGCATTAGTTTAGA
>probe:Drosophila_2:1625303_at:362:459; Interrogation_Position=975; Antisense; GATATATTCTCATTTTACGTGTGCT
>probe:Drosophila_2:1625303_at:399:281; Interrogation_Position=983; Antisense; CTCATTTTACGTGTGCTACAGGTAA
>probe:Drosophila_2:1625303_at:360:685; Interrogation_Position=989; Antisense; TTACGTGTGCTACAGGTAAGTGTAT
>probe:Drosophila_2:1625303_at:179:339; Interrogation_Position=997; Antisense; GCTACAGGTAAGTGTATTGTCTTGA

Paste this into a BLAST search page for me
GTGTATTGTCTTGATTTATTTGGCTTATTGTCTTGATTTATTTGGCTTAACGATGGTCCAAAACAAGATGCATATAACAAGATGCATATGCGGCCAGGGACAAGATGCATATGCGGCCAGGGAATTATGCGGCCAGGGAATACGTGCTACGCGGCCAGGGAATACGTGCTACGTATACGTGCTACGTATGTTTCAAAGCAGCTACGTATGTTTCAAAGCATTAGTGTATGTTTCAAAGCATTAGTTTAGAGATATATTCTCATTTTACGTGTGCTCTCATTTTACGTGTGCTACAGGTAATTACGTGTGCTACAGGTAAGTGTATGCTACAGGTAAGTGTATTGTCTTGA

Full Affymetrix probeset data:

Annotations for 1625303_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720