Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625304_s_at:

>probe:Drosophila_2:1625304_s_at:528:69; Interrogation_Position=107; Antisense; AGGCCAACGATCTGTGGAAGCACAA
>probe:Drosophila_2:1625304_s_at:52:595; Interrogation_Position=119; Antisense; TGTGGAAGCACAACGAACCGAAGGA
>probe:Drosophila_2:1625304_s_at:63:417; Interrogation_Position=145; Antisense; GAGCCCAGAAACCAAATTCCTGATT
>probe:Drosophila_2:1625304_s_at:399:531; Interrogation_Position=15; Antisense; GGGTCACCTGCAGTTGGATTTCCAT
>probe:Drosophila_2:1625304_s_at:258:247; Interrogation_Position=159; Antisense; AATTCCTGATTTTGGCCAGCGTTAC
>probe:Drosophila_2:1625304_s_at:449:15; Interrogation_Position=167; Antisense; ATTTTGGCCAGCGTTACGGCCGATA
>probe:Drosophila_2:1625304_s_at:661:139; Interrogation_Position=182; Antisense; ACGGCCGATAAGATTGAGCCATCCT
>probe:Drosophila_2:1625304_s_at:270:465; Interrogation_Position=193; Antisense; GATTGAGCCATCCTACGATGATCAA
>probe:Drosophila_2:1625304_s_at:686:255; Interrogation_Position=215; Antisense; CAAAGCTGTTCGTACATTTTCCAAA
>probe:Drosophila_2:1625304_s_at:698:65; Interrogation_Position=242; Antisense; ATGGAGAGTCGATTCGGGCCTTTTA
>probe:Drosophila_2:1625304_s_at:666:543; Interrogation_Position=30; Antisense; GGATTTCCATTCCATACCTAAGCTC
>probe:Drosophila_2:1625304_s_at:175:297; Interrogation_Position=41; Antisense; CCATACCTAAGCTCCATGGCAGGGA
>probe:Drosophila_2:1625304_s_at:482:107; Interrogation_Position=65; Antisense; AGAACTATTGGCAGTGGCGCATCCT
>probe:Drosophila_2:1625304_s_at:320:345; Interrogation_Position=83; Antisense; GCATCCTCCTGAAGACCTTTCTGGA

Paste this into a BLAST search page for me
AGGCCAACGATCTGTGGAAGCACAATGTGGAAGCACAACGAACCGAAGGAGAGCCCAGAAACCAAATTCCTGATTGGGTCACCTGCAGTTGGATTTCCATAATTCCTGATTTTGGCCAGCGTTACATTTTGGCCAGCGTTACGGCCGATAACGGCCGATAAGATTGAGCCATCCTGATTGAGCCATCCTACGATGATCAACAAAGCTGTTCGTACATTTTCCAAAATGGAGAGTCGATTCGGGCCTTTTAGGATTTCCATTCCATACCTAAGCTCCCATACCTAAGCTCCATGGCAGGGAAGAACTATTGGCAGTGGCGCATCCTGCATCCTCCTGAAGACCTTTCTGGA

Full Affymetrix probeset data:

Annotations for 1625304_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime