FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625305_at:

>probe:Drosophila_2:1625305_at:136:327; Interrogation_Position=1263; Antisense; GCGAGTCGTTTACCAGGGCAAGCTA
>probe:Drosophila_2:1625305_at:188:83; Interrogation_Position=1277; Antisense; AGGGCAAGCTATTCGATTCCTTTCG
>probe:Drosophila_2:1625305_at:663:463; Interrogation_Position=1291; Antisense; GATTCCTTTCGATTGCCGTATCATA
>probe:Drosophila_2:1625305_at:699:75; Interrogation_Position=1373; Antisense; AGGAGTATCTCGACTACTATCCGCG
>probe:Drosophila_2:1625305_at:461:683; Interrogation_Position=1390; Antisense; TATCCGCGCGAGTTGACTGTCCTAA
>probe:Drosophila_2:1625305_at:131:491; Interrogation_Position=1469; Antisense; GTAAATTTACGACTACCTCCCTGAT
>probe:Drosophila_2:1625305_at:148:553; Interrogation_Position=1554; Antisense; GGAGCACATCTTTCTCTACCAAATG
>probe:Drosophila_2:1625305_at:591:125; Interrogation_Position=1571; Antisense; ACCAAATGGTCATCTACTTGCGCCG
>probe:Drosophila_2:1625305_at:246:339; Interrogation_Position=1605; Antisense; GCTAAAGTTCGCCTTCGATCGGAAA
>probe:Drosophila_2:1625305_at:151:161; Interrogation_Position=1628; Antisense; AAATTAAACAGCTCCTGTCTGCCGG
>probe:Drosophila_2:1625305_at:141:625; Interrogation_Position=1670; Antisense; TGCGCGAATTCGATGCCTGTCAGTA
>probe:Drosophila_2:1625305_at:497:9; Interrogation_Position=1742; Antisense; ATTCCTTCTGCGGTCTTTACTATAT
>probe:Drosophila_2:1625305_at:268:633; Interrogation_Position=1783; Antisense; TCCGCAGCTGTTGTTGCTTTTATCT
>probe:Drosophila_2:1625305_at:558:419; Interrogation_Position=1810; Antisense; GAGCTTCTCAGCCAACGGATTGTCT

Paste this into a BLAST search page for me
GCGAGTCGTTTACCAGGGCAAGCTAAGGGCAAGCTATTCGATTCCTTTCGGATTCCTTTCGATTGCCGTATCATAAGGAGTATCTCGACTACTATCCGCGTATCCGCGCGAGTTGACTGTCCTAAGTAAATTTACGACTACCTCCCTGATGGAGCACATCTTTCTCTACCAAATGACCAAATGGTCATCTACTTGCGCCGGCTAAAGTTCGCCTTCGATCGGAAAAAATTAAACAGCTCCTGTCTGCCGGTGCGCGAATTCGATGCCTGTCAGTAATTCCTTCTGCGGTCTTTACTATATTCCGCAGCTGTTGTTGCTTTTATCTGAGCTTCTCAGCCAACGGATTGTCT

Full Affymetrix probeset data:

Annotations for 1625305_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720