FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625306_at:

>probe:Drosophila_2:1625306_at:84:673; Interrogation_Position=16; Antisense; TACGCATTCTTTGCAGTTGGCGAGA
>probe:Drosophila_2:1625306_at:93:119; Interrogation_Position=188; Antisense; AGCTCGTGCCCAATGAATCACAGCA
>probe:Drosophila_2:1625306_at:424:365; Interrogation_Position=202; Antisense; GAATCACAGCAACAAAGCTGGCCAA
>probe:Drosophila_2:1625306_at:276:581; Interrogation_Position=220; Antisense; TGGCCAACAGCTGATGAGCCAGCGG
>probe:Drosophila_2:1625306_at:147:109; Interrogation_Position=288; Antisense; AGAAGAACTACAACACCCACGGGAT
>probe:Drosophila_2:1625306_at:686:259; Interrogation_Position=301; Antisense; CACCCACGGGATGAGGTTGTTGCAT
>probe:Drosophila_2:1625306_at:70:57; Interrogation_Position=311; Antisense; ATGAGGTTGTTGCATCTGATGCTGC
>probe:Drosophila_2:1625306_at:21:41; Interrogation_Position=324; Antisense; ATCTGATGCTGCTGCCAATGCCAAC
>probe:Drosophila_2:1625306_at:75:223; Interrogation_Position=340; Antisense; AATGCCAACGGACACTGCAAGTCCT
>probe:Drosophila_2:1625306_at:43:157; Interrogation_Position=351; Antisense; ACACTGCAAGTCCTCTGGTCCACAT
>probe:Drosophila_2:1625306_at:555:495; Interrogation_Position=398; Antisense; GTCACTGGGCACTGGCCAGTGGACA
>probe:Drosophila_2:1625306_at:32:559; Interrogation_Position=418; Antisense; GGACACTGTGGAATGCTCCTGGAAA
>probe:Drosophila_2:1625306_at:2:57; Interrogation_Position=47; Antisense; ATGAGGAAAACACCGGACTGCTGGA
>probe:Drosophila_2:1625306_at:320:143; Interrogation_Position=56; Antisense; ACACCGGACTGCTGGAGCCCAAGGA

Paste this into a BLAST search page for me
TACGCATTCTTTGCAGTTGGCGAGAAGCTCGTGCCCAATGAATCACAGCAGAATCACAGCAACAAAGCTGGCCAATGGCCAACAGCTGATGAGCCAGCGGAGAAGAACTACAACACCCACGGGATCACCCACGGGATGAGGTTGTTGCATATGAGGTTGTTGCATCTGATGCTGCATCTGATGCTGCTGCCAATGCCAACAATGCCAACGGACACTGCAAGTCCTACACTGCAAGTCCTCTGGTCCACATGTCACTGGGCACTGGCCAGTGGACAGGACACTGTGGAATGCTCCTGGAAAATGAGGAAAACACCGGACTGCTGGAACACCGGACTGCTGGAGCCCAAGGA

Full Affymetrix probeset data:

Annotations for 1625306_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720