FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625307_at:

>probe:Drosophila_2:1625307_at:41:563; Interrogation_Position=1015; Antisense; GGAAGCTTCAATCTGTGCACATCCC
>probe:Drosophila_2:1625307_at:152:527; Interrogation_Position=1044; Antisense; GGGACCATTACTAATCCGCAGGTTT
>probe:Drosophila_2:1625307_at:489:633; Interrogation_Position=1068; Antisense; TCCGCGTCGACCTCTAATGATGATT
>probe:Drosophila_2:1625307_at:88:231; Interrogation_Position=1083; Antisense; AATGATGATTTCCTGCTCCATGTGT
>probe:Drosophila_2:1625307_at:503:101; Interrogation_Position=1151; Antisense; AGAGATCAGAGAGCACGGTCCTCAC
>probe:Drosophila_2:1625307_at:29:277; Interrogation_Position=1191; Antisense; CTTCATTCTAACATTCATCCTCGGT
>probe:Drosophila_2:1625307_at:687:497; Interrogation_Position=1226; Antisense; GTCTGGGACCAATTGCTTACTTCAT
>probe:Drosophila_2:1625307_at:596:3; Interrogation_Position=1249; Antisense; ATTGGCTCAGAGCTCCTCGAGGATT
>probe:Drosophila_2:1625307_at:694:353; Interrogation_Position=1301; Antisense; GCAGCCTTTTCTCGTGGATCGGAAA
>probe:Drosophila_2:1625307_at:119:179; Interrogation_Position=1323; Antisense; AAACTTCCTAGTGGGCATGTGCTTT
>probe:Drosophila_2:1625307_at:346:63; Interrogation_Position=1339; Antisense; ATGTGCTTTCCATTGCTGCAGAGTG
>probe:Drosophila_2:1625307_at:244:63; Interrogation_Position=1393; Antisense; ATGTGCGTGTGCATCTACTGCCTTC
>probe:Drosophila_2:1625307_at:550:579; Interrogation_Position=1426; Antisense; TGGCGTTACCTTCCAGAGACACGTG
>probe:Drosophila_2:1625307_at:362:569; Interrogation_Position=1490; Antisense; GGCTTTCCTCCAAGCTGAACTAAAG

Paste this into a BLAST search page for me
GGAAGCTTCAATCTGTGCACATCCCGGGACCATTACTAATCCGCAGGTTTTCCGCGTCGACCTCTAATGATGATTAATGATGATTTCCTGCTCCATGTGTAGAGATCAGAGAGCACGGTCCTCACCTTCATTCTAACATTCATCCTCGGTGTCTGGGACCAATTGCTTACTTCATATTGGCTCAGAGCTCCTCGAGGATTGCAGCCTTTTCTCGTGGATCGGAAAAAACTTCCTAGTGGGCATGTGCTTTATGTGCTTTCCATTGCTGCAGAGTGATGTGCGTGTGCATCTACTGCCTTCTGGCGTTACCTTCCAGAGACACGTGGGCTTTCCTCCAAGCTGAACTAAAG

Full Affymetrix probeset data:

Annotations for 1625307_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720