Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625310_at:

>probe:Drosophila_2:1625310_at:543:263; Interrogation_Position=2117; Antisense; CAGCTTGTTTGAATTATTTGTTCAC
>probe:Drosophila_2:1625310_at:240:1; Interrogation_Position=2161; Antisense; TCGGGAAGTTCACAATTTTTTACAG
>probe:Drosophila_2:1625310_at:152:709; Interrogation_Position=2169; Antisense; TTCACAATTTTTTACAGACTTTACG
>probe:Drosophila_2:1625310_at:214:497; Interrogation_Position=2198; Antisense; GTCTTTTATTACTCATTCAGCTCGG
>probe:Drosophila_2:1625310_at:680:13; Interrogation_Position=2205; Antisense; ATTACTCATTCAGCTCGGGTTGCAA
>probe:Drosophila_2:1625310_at:69:711; Interrogation_Position=2213; Antisense; TTCAGCTCGGGTTGCAAACGACATT
>probe:Drosophila_2:1625310_at:504:289; Interrogation_Position=2220; Antisense; CGGGTTGCAAACGACATTATTGTAA
>probe:Drosophila_2:1625310_at:529:659; Interrogation_Position=2272; Antisense; TAAGCCATCCAAAACGTTTTCAGTG
>probe:Drosophila_2:1625310_at:443:699; Interrogation_Position=2288; Antisense; TTTTCAGTGAAAATGCTAGCTTACC
>probe:Drosophila_2:1625310_at:97:341; Interrogation_Position=2302; Antisense; GCTAGCTTACCAAATGAACGATTAT
>probe:Drosophila_2:1625310_at:417:487; Interrogation_Position=2511; Antisense; GTAAAAAATACACCTCCGACTTGCA
>probe:Drosophila_2:1625310_at:556:125; Interrogation_Position=2522; Antisense; ACCTCCGACTTGCAAACCAATCAAA
>probe:Drosophila_2:1625310_at:727:367; Interrogation_Position=2638; Antisense; GAATGTATGCATCTTTTCAGGGATA
>probe:Drosophila_2:1625310_at:342:641; Interrogation_Position=2654; Antisense; TCAGGGATACTAATATTAGCCTATA

Paste this into a BLAST search page for me
CAGCTTGTTTGAATTATTTGTTCACTCGGGAAGTTCACAATTTTTTACAGTTCACAATTTTTTACAGACTTTACGGTCTTTTATTACTCATTCAGCTCGGATTACTCATTCAGCTCGGGTTGCAATTCAGCTCGGGTTGCAAACGACATTCGGGTTGCAAACGACATTATTGTAATAAGCCATCCAAAACGTTTTCAGTGTTTTCAGTGAAAATGCTAGCTTACCGCTAGCTTACCAAATGAACGATTATGTAAAAAATACACCTCCGACTTGCAACCTCCGACTTGCAAACCAATCAAAGAATGTATGCATCTTTTCAGGGATATCAGGGATACTAATATTAGCCTATA

Full Affymetrix probeset data:

Annotations for 1625310_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime