FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625313_at:

>probe:Drosophila_2:1625313_at:4:119; Interrogation_Position=109; Antisense; AGCTACGAAAACTACGACACAGATC
>probe:Drosophila_2:1625313_at:265:41; Interrogation_Position=131; Antisense; ATCGCTATGACAGCTACGGCGGGTC
>probe:Drosophila_2:1625313_at:62:545; Interrogation_Position=15; Antisense; GGATCTTAAGCAATTGTACTCGTGG
>probe:Drosophila_2:1625313_at:548:141; Interrogation_Position=187; Antisense; ACGGACAACCGCCTTAAGAAGCTGA
>probe:Drosophila_2:1625313_at:126:211; Interrogation_Position=202; Antisense; AAGAAGCTGAGTCCGGGCTACTACT
>probe:Drosophila_2:1625313_at:57:587; Interrogation_Position=230; Antisense; TGGACGATGGGTACATCGCCCCGGT
>probe:Drosophila_2:1625313_at:248:601; Interrogation_Position=29; Antisense; TGTACTCGTGGATCTGCCTGCTGAT
>probe:Drosophila_2:1625313_at:661:627; Interrogation_Position=310; Antisense; TCCTTGCCCCACAATGTCAAGTTTA
>probe:Drosophila_2:1625313_at:168:231; Interrogation_Position=322; Antisense; AATGTCAAGTTTACTCCCATCGTGC
>probe:Drosophila_2:1625313_at:44:625; Interrogation_Position=344; Antisense; TGCGCGTCCGGCAGACCAAGACCAA
>probe:Drosophila_2:1625313_at:572:203; Interrogation_Position=367; Antisense; AAGCGCAAGAAGCTCTTCGTGCCCA
>probe:Drosophila_2:1625313_at:31:275; Interrogation_Position=381; Antisense; CTTCGTGCCCAACTTCTTTGGCTAG
>probe:Drosophila_2:1625313_at:335:645; Interrogation_Position=62; Antisense; TCATCTGCAAAGTGTCCGAGGCCAA
>probe:Drosophila_2:1625313_at:51:205; Interrogation_Position=85; Antisense; AAGCCCACCTACTACGACTTGGATA

Paste this into a BLAST search page for me
AGCTACGAAAACTACGACACAGATCATCGCTATGACAGCTACGGCGGGTCGGATCTTAAGCAATTGTACTCGTGGACGGACAACCGCCTTAAGAAGCTGAAAGAAGCTGAGTCCGGGCTACTACTTGGACGATGGGTACATCGCCCCGGTTGTACTCGTGGATCTGCCTGCTGATTCCTTGCCCCACAATGTCAAGTTTAAATGTCAAGTTTACTCCCATCGTGCTGCGCGTCCGGCAGACCAAGACCAAAAGCGCAAGAAGCTCTTCGTGCCCACTTCGTGCCCAACTTCTTTGGCTAGTCATCTGCAAAGTGTCCGAGGCCAAAAGCCCACCTACTACGACTTGGATA

Full Affymetrix probeset data:

Annotations for 1625313_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720