Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625314_at:

>probe:Drosophila_2:1625314_at:70:665; Interrogation_Position=109; Antisense; TACAAAGTCCTACGCGGCATGATAT
>probe:Drosophila_2:1625314_at:71:569; Interrogation_Position=124; Antisense; GGCATGATATCGTATGGCACCCTCT
>probe:Drosophila_2:1625314_at:238:375; Interrogation_Position=189; Antisense; GAAGACATTCCGGACGTACGACTGG
>probe:Drosophila_2:1625314_at:111:87; Interrogation_Position=218; Antisense; AGTGCCTTAGGTTCAGCTTATTCGG
>probe:Drosophila_2:1625314_at:119:341; Interrogation_Position=233; Antisense; GCTTATTCGGCTTCTTCTTTATGGG
>probe:Drosophila_2:1625314_at:272:679; Interrogation_Position=294; Antisense; TATGTGGCCGCGCACCGACATTAAG
>probe:Drosophila_2:1625314_at:99:403; Interrogation_Position=310; Antisense; GACATTAAGTCATCGCTCTGCAAGG
>probe:Drosophila_2:1625314_at:105:421; Interrogation_Position=343; Antisense; GAGCAGACCGCTTATGATCCGATGG
>probe:Drosophila_2:1625314_at:233:471; Interrogation_Position=378; Antisense; GTTCCTCTTCTTCATGACCTTGATG
>probe:Drosophila_2:1625314_at:479:509; Interrogation_Position=436; Antisense; GTGAACGATAAATTCCTGGACGCCT
>probe:Drosophila_2:1625314_at:727:327; Interrogation_Position=470; Antisense; GCGTTATTTATTGGCCCTGCGTGCA
>probe:Drosophila_2:1625314_at:268:617; Interrogation_Position=491; Antisense; TGCAGACGGTGAACTTCGCCTTTGT
>probe:Drosophila_2:1625314_at:34:603; Interrogation_Position=536; Antisense; TGTTTACCTCCTTCTTCAGCATGTG
>probe:Drosophila_2:1625314_at:566:557; Interrogation_Position=633; Antisense; GGACATCCACTTCCTGGAGATGTGA

Paste this into a BLAST search page for me
TACAAAGTCCTACGCGGCATGATATGGCATGATATCGTATGGCACCCTCTGAAGACATTCCGGACGTACGACTGGAGTGCCTTAGGTTCAGCTTATTCGGGCTTATTCGGCTTCTTCTTTATGGGTATGTGGCCGCGCACCGACATTAAGGACATTAAGTCATCGCTCTGCAAGGGAGCAGACCGCTTATGATCCGATGGGTTCCTCTTCTTCATGACCTTGATGGTGAACGATAAATTCCTGGACGCCTGCGTTATTTATTGGCCCTGCGTGCATGCAGACGGTGAACTTCGCCTTTGTTGTTTACCTCCTTCTTCAGCATGTGGGACATCCACTTCCTGGAGATGTGA

Full Affymetrix probeset data:

Annotations for 1625314_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime