FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625315_at:

>probe:Drosophila_2:1625315_at:274:137; Interrogation_Position=206; Antisense; ACGATGGATGGGTTCCTGTCTATAC
>probe:Drosophila_2:1625315_at:545:443; Interrogation_Position=232; Antisense; GATGAATCCCAAACCTTGGCGGTGA
>probe:Drosophila_2:1625315_at:543:77; Interrogation_Position=287; Antisense; AGGATCCGGTCATTTGGCGTGGTCC
>probe:Drosophila_2:1625315_at:151:173; Interrogation_Position=315; Antisense; AAAGACCATGATGATCCGGCAGTTC
>probe:Drosophila_2:1625315_at:616:77; Interrogation_Position=437; Antisense; AGGTTGGTTGCCACGGAGCCATAAT
>probe:Drosophila_2:1625315_at:236:653; Interrogation_Position=458; Antisense; TAATTGTGACCACACCGCAGGAGGT
>probe:Drosophila_2:1625315_at:464:103; Interrogation_Position=524; Antisense; AGACCGGCATCAATATCCTGGGCAT
>probe:Drosophila_2:1625315_at:256:243; Interrogation_Position=535; Antisense; AATATCCTGGGCATCGTCGAGAATA
>probe:Drosophila_2:1625315_at:623:281; Interrogation_Position=588; Antisense; CTCGTGCACCAATATATTCTCGTCA
>probe:Drosophila_2:1625315_at:90:13; Interrogation_Position=603; Antisense; ATTCTCGTCAAACGGTGGCGTCTCA
>probe:Drosophila_2:1625315_at:150:669; Interrogation_Position=637; Antisense; TACGCCCAAGTACCACATCTAGGAA
>probe:Drosophila_2:1625315_at:594:1; Interrogation_Position=670; Antisense; ATAGATCCCCGTGTTGGCATTTTGG
>probe:Drosophila_2:1625315_at:289:147; Interrogation_Position=703; Antisense; ACTACGTCCGTCTTGGATGAGCTTC
>probe:Drosophila_2:1625315_at:169:445; Interrogation_Position=718; Antisense; GATGAGCTTCCGGATTCCACGACAG

Paste this into a BLAST search page for me
ACGATGGATGGGTTCCTGTCTATACGATGAATCCCAAACCTTGGCGGTGAAGGATCCGGTCATTTGGCGTGGTCCAAAGACCATGATGATCCGGCAGTTCAGGTTGGTTGCCACGGAGCCATAATTAATTGTGACCACACCGCAGGAGGTAGACCGGCATCAATATCCTGGGCATAATATCCTGGGCATCGTCGAGAATACTCGTGCACCAATATATTCTCGTCAATTCTCGTCAAACGGTGGCGTCTCATACGCCCAAGTACCACATCTAGGAAATAGATCCCCGTGTTGGCATTTTGGACTACGTCCGTCTTGGATGAGCTTCGATGAGCTTCCGGATTCCACGACAG

Full Affymetrix probeset data:

Annotations for 1625315_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720