FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625317_at:

>probe:Drosophila_2:1625317_at:645:103; Interrogation_Position=1667; Antisense; AGACGACCTTCGACGATCGGTTCCA
>probe:Drosophila_2:1625317_at:29:43; Interrogation_Position=1682; Antisense; ATCGGTTCCAGTACTTCGTCAAGAA
>probe:Drosophila_2:1625317_at:610:689; Interrogation_Position=1707; Antisense; TATTATGCCCCAATTCAGTAAGCCC
>probe:Drosophila_2:1625317_at:678:657; Interrogation_Position=1725; Antisense; TAAGCCCGGTTTCTCGCACTGTATG
>probe:Drosophila_2:1625317_at:451:143; Interrogation_Position=1742; Antisense; ACTGTATGCTATACGTGCCCAGCTA
>probe:Drosophila_2:1625317_at:252:299; Interrogation_Position=1759; Antisense; CCCAGCTACTTTGACTACGTACGGA
>probe:Drosophila_2:1625317_at:37:489; Interrogation_Position=1777; Antisense; GTACGGATACGCAACCATTTCAAGA
>probe:Drosophila_2:1625317_at:687:425; Interrogation_Position=1863; Antisense; GAGAGATATATTCTTCCACAGCGGG
>probe:Drosophila_2:1625317_at:718:569; Interrogation_Position=1887; Antisense; GGCATCTGTTCTGTTGTACTCGGAA
>probe:Drosophila_2:1625317_at:653:489; Interrogation_Position=1902; Antisense; GTACTCGGAAAGAGCGCACTTCTTC
>probe:Drosophila_2:1625317_at:455:561; Interrogation_Position=1952; Antisense; GGAACTTGATCATGTACCAGCCGCC
>probe:Drosophila_2:1625317_at:516:297; Interrogation_Position=1985; Antisense; CGCACTTCTATTCCGAGATCATCAA
>probe:Drosophila_2:1625317_at:244:61; Interrogation_Position=2059; Antisense; ATGTCCGTCAGTATCCTGTACACAA
>probe:Drosophila_2:1625317_at:545:233; Interrogation_Position=2125; Antisense; AATGCTGCGAAATTGACTTCTGGTC

Paste this into a BLAST search page for me
AGACGACCTTCGACGATCGGTTCCAATCGGTTCCAGTACTTCGTCAAGAATATTATGCCCCAATTCAGTAAGCCCTAAGCCCGGTTTCTCGCACTGTATGACTGTATGCTATACGTGCCCAGCTACCCAGCTACTTTGACTACGTACGGAGTACGGATACGCAACCATTTCAAGAGAGAGATATATTCTTCCACAGCGGGGGCATCTGTTCTGTTGTACTCGGAAGTACTCGGAAAGAGCGCACTTCTTCGGAACTTGATCATGTACCAGCCGCCCGCACTTCTATTCCGAGATCATCAAATGTCCGTCAGTATCCTGTACACAAAATGCTGCGAAATTGACTTCTGGTC

Full Affymetrix probeset data:

Annotations for 1625317_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720