FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625320_at:

>probe:Drosophila_2:1625320_at:69:19; Interrogation_Position=208; Antisense; ATTTCAGGCACACGTCTTCCACGAA
>probe:Drosophila_2:1625320_at:49:259; Interrogation_Position=227; Antisense; CACGAATCGCACTTCCAATCGAAAA
>probe:Drosophila_2:1625320_at:35:411; Interrogation_Position=269; Antisense; GACGACGGCGTCCAAAAATCGCACA
>probe:Drosophila_2:1625320_at:290:573; Interrogation_Position=305; Antisense; GGCGGCATGGAACTGAATCCCGAAT
>probe:Drosophila_2:1625320_at:159:111; Interrogation_Position=339; Antisense; AGAAGGCGCGCCACGAGGTGCTCAA
>probe:Drosophila_2:1625320_at:386:435; Interrogation_Position=353; Antisense; GAGGTGCTCAATTTTGCGATCAAAA
>probe:Drosophila_2:1625320_at:108:121; Interrogation_Position=429; Antisense; AGCTGGGCGCCAAGCCGCTGAAGAA
>probe:Drosophila_2:1625320_at:287:555; Interrogation_Position=481; Antisense; GGACGAACGCCAGCGGCTGAAGAAT
>probe:Drosophila_2:1625320_at:216:211; Interrogation_Position=521; Antisense; AAGAAGTTCCATCAGTTGGGCAAAA
>probe:Drosophila_2:1625320_at:57:565; Interrogation_Position=539; Antisense; GGCAAAAATCAAACGGGCGCCGCCA
>probe:Drosophila_2:1625320_at:70:313; Interrogation_Position=560; Antisense; GCCAGCGTCAAATGCCGAACAAAAT
>probe:Drosophila_2:1625320_at:172:479; Interrogation_Position=620; Antisense; GTTTCACACATCGATCAGCACTACG
>probe:Drosophila_2:1625320_at:502:135; Interrogation_Position=642; Antisense; ACGGCAAGGCGCAGCCCAAGTTTAA
>probe:Drosophila_2:1625320_at:591:701; Interrogation_Position=750; Antisense; TTATCTATTCTAGCCCTAACGTCAG

Paste this into a BLAST search page for me
ATTTCAGGCACACGTCTTCCACGAACACGAATCGCACTTCCAATCGAAAAGACGACGGCGTCCAAAAATCGCACAGGCGGCATGGAACTGAATCCCGAATAGAAGGCGCGCCACGAGGTGCTCAAGAGGTGCTCAATTTTGCGATCAAAAAGCTGGGCGCCAAGCCGCTGAAGAAGGACGAACGCCAGCGGCTGAAGAATAAGAAGTTCCATCAGTTGGGCAAAAGGCAAAAATCAAACGGGCGCCGCCAGCCAGCGTCAAATGCCGAACAAAATGTTTCACACATCGATCAGCACTACGACGGCAAGGCGCAGCCCAAGTTTAATTATCTATTCTAGCCCTAACGTCAG

Full Affymetrix probeset data:

Annotations for 1625320_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720