FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625322_at:

>probe:Drosophila_2:1625322_at:209:633; Interrogation_Position=106; Antisense; TCCCGGTTGGATTTTTGATGAAGAG
>probe:Drosophila_2:1625322_at:706:449; Interrogation_Position=15; Antisense; GATCGTTTTTGAATTACCTGTAGAA
>probe:Drosophila_2:1625322_at:346:319; Interrogation_Position=188; Antisense; GCCCGTTTACGGTTGCTGCCAAAAT
>probe:Drosophila_2:1625322_at:438:469; Interrogation_Position=199; Antisense; GTTGCTGCCAAAATGTTTGCCTTGA
>probe:Drosophila_2:1625322_at:452:715; Interrogation_Position=215; Antisense; TTGCCTTGACGCTTTTAACCTTGAT
>probe:Drosophila_2:1625322_at:608:201; Interrogation_Position=231; Antisense; AACCTTGATGGATTCGCTTTTGGAG
>probe:Drosophila_2:1625322_at:565:243; Interrogation_Position=282; Antisense; AATTTTAAGGATGCGCAACTGGGAA
>probe:Drosophila_2:1625322_at:96:45; Interrogation_Position=307; Antisense; ATGCCGCAAAAGGTTATTCCACTTG
>probe:Drosophila_2:1625322_at:3:9; Interrogation_Position=322; Antisense; ATTCCACTTGTTGGCATGGACCAGC
>probe:Drosophila_2:1625322_at:579:127; Interrogation_Position=341; Antisense; ACCAGCGCGCAGAGTTTTCAATCAG
>probe:Drosophila_2:1625322_at:559:343; Interrogation_Position=373; Antisense; GCAGAAATGGTCAGTCCGACGGACA
>probe:Drosophila_2:1625322_at:221:249; Interrogation_Position=38; Antisense; AATTGGCCGAGAAACCGTGCATTAT
>probe:Drosophila_2:1625322_at:623:417; Interrogation_Position=404; Antisense; GAGCGTCGCTGCAAGGCCAATGAAC
>probe:Drosophila_2:1625322_at:398:611; Interrogation_Position=90; Antisense; TGAAAAGAAGCTGGTTTCCCGGTTG

Paste this into a BLAST search page for me
TCCCGGTTGGATTTTTGATGAAGAGGATCGTTTTTGAATTACCTGTAGAAGCCCGTTTACGGTTGCTGCCAAAATGTTGCTGCCAAAATGTTTGCCTTGATTGCCTTGACGCTTTTAACCTTGATAACCTTGATGGATTCGCTTTTGGAGAATTTTAAGGATGCGCAACTGGGAAATGCCGCAAAAGGTTATTCCACTTGATTCCACTTGTTGGCATGGACCAGCACCAGCGCGCAGAGTTTTCAATCAGGCAGAAATGGTCAGTCCGACGGACAAATTGGCCGAGAAACCGTGCATTATGAGCGTCGCTGCAAGGCCAATGAACTGAAAAGAAGCTGGTTTCCCGGTTG

Full Affymetrix probeset data:

Annotations for 1625322_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720