FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625324_at:

>probe:Drosophila_2:1625324_at:722:185; Interrogation_Position=1424; Antisense; AACACTCAGATCTACTCCATGCTTG
>probe:Drosophila_2:1625324_at:75:611; Interrogation_Position=1461; Antisense; TGAACAATGCCGTGGGAGCCTTTGC
>probe:Drosophila_2:1625324_at:550:693; Interrogation_Position=1481; Antisense; TTTGCCCTGTTCAAGTTCACCCAGT
>probe:Drosophila_2:1625324_at:4:601; Interrogation_Position=1551; Antisense; TGTACGTGCAGCTGGGCATCCTGGT
>probe:Drosophila_2:1625324_at:411:63; Interrogation_Position=1580; Antisense; ATGGGAACCATTGGCACCATTGCCT
>probe:Drosophila_2:1625324_at:552:7; Interrogation_Position=1598; Antisense; ATTGCCTTCGTCTTCGTAGAGTGGG
>probe:Drosophila_2:1625324_at:465:209; Interrogation_Position=1661; Antisense; AAGTAATTCCGTTGTGGGACTCAGA
>probe:Drosophila_2:1625324_at:220:475; Interrogation_Position=1714; Antisense; GTTAGAACTCTAGGGCTAGGGCCAT
>probe:Drosophila_2:1625324_at:429:679; Interrogation_Position=1730; Antisense; TAGGGCCATTTGTCCGTGTTTGTTA
>probe:Drosophila_2:1625324_at:513:291; Interrogation_Position=1744; Antisense; CGTGTTTGTTAAATTCCTCGGAATG
>probe:Drosophila_2:1625324_at:723:231; Interrogation_Position=1765; Antisense; AATGCTTTAAATCCGTGCGACTGCG
>probe:Drosophila_2:1625324_at:205:145; Interrogation_Position=1784; Antisense; ACTGCGTCGTCTTCCTAGACAATAA
>probe:Drosophila_2:1625324_at:565:141; Interrogation_Position=1808; Antisense; ACTGATAAGTGTTGTTGCGCGCTAT
>probe:Drosophila_2:1625324_at:194:727; Interrogation_Position=1819; Antisense; TTGTTGCGCGCTATTGTTGCTAAAT

Paste this into a BLAST search page for me
AACACTCAGATCTACTCCATGCTTGTGAACAATGCCGTGGGAGCCTTTGCTTTGCCCTGTTCAAGTTCACCCAGTTGTACGTGCAGCTGGGCATCCTGGTATGGGAACCATTGGCACCATTGCCTATTGCCTTCGTCTTCGTAGAGTGGGAAGTAATTCCGTTGTGGGACTCAGAGTTAGAACTCTAGGGCTAGGGCCATTAGGGCCATTTGTCCGTGTTTGTTACGTGTTTGTTAAATTCCTCGGAATGAATGCTTTAAATCCGTGCGACTGCGACTGCGTCGTCTTCCTAGACAATAAACTGATAAGTGTTGTTGCGCGCTATTTGTTGCGCGCTATTGTTGCTAAAT

Full Affymetrix probeset data:

Annotations for 1625324_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720