Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625326_a_at:

>probe:Drosophila_2:1625326_a_at:618:477; Interrogation_Position=524; Antisense; GTTTTAGCCATGTGCCGGCCATAAA
>probe:Drosophila_2:1625326_a_at:621:375; Interrogation_Position=551; Antisense; GAAGACACGCTTCCTAATTGAAAAC
>probe:Drosophila_2:1625326_a_at:206:407; Interrogation_Position=659; Antisense; GACGATCGTGATTTGGATTTTCAGC
>probe:Drosophila_2:1625326_a_at:164:183; Interrogation_Position=692; Antisense; AAAACGGAGCGGACAGCAGTCGAGC
>probe:Drosophila_2:1625326_a_at:505:239; Interrogation_Position=750; Antisense; AATCACGCCAAAATGTTCAACACCA
>probe:Drosophila_2:1625326_a_at:20:13; Interrogation_Position=793; Antisense; ATAGAATTTTATGGCTTTCCGGCGT
>probe:Drosophila_2:1625326_a_at:356:707; Interrogation_Position=819; Antisense; TTACTAGGTCCTATTTTGCTGGCCG
>probe:Drosophila_2:1625326_a_at:654:723; Interrogation_Position=834; Antisense; TTGCTGGCCGCCATTGCGGTTCAAG
>probe:Drosophila_2:1625326_a_at:467:541; Interrogation_Position=851; Antisense; GGTTCAAGGCCAAGAGCCAGCCAGT
>probe:Drosophila_2:1625326_a_at:168:313; Interrogation_Position=866; Antisense; GCCAGCCAGTCCAGTATTTCAAAAT
>probe:Drosophila_2:1625326_a_at:30:687; Interrogation_Position=923; Antisense; TATAACATTCTCATTCGATTGCAAG
>probe:Drosophila_2:1625326_a_at:467:251; Interrogation_Position=944; Antisense; CAAGAGGCGTTCTGTGGGCTTCTAT
>probe:Drosophila_2:1625326_a_at:157:571; Interrogation_Position=960; Antisense; GGCTTCTATGCCGACATGGAGTACA
>probe:Drosophila_2:1625326_a_at:227:721; Interrogation_Position=986; Antisense; TTGCCAGATCTTTCACATGTGCGAC

Paste this into a BLAST search page for me
GTTTTAGCCATGTGCCGGCCATAAAGAAGACACGCTTCCTAATTGAAAACGACGATCGTGATTTGGATTTTCAGCAAAACGGAGCGGACAGCAGTCGAGCAATCACGCCAAAATGTTCAACACCAATAGAATTTTATGGCTTTCCGGCGTTTACTAGGTCCTATTTTGCTGGCCGTTGCTGGCCGCCATTGCGGTTCAAGGGTTCAAGGCCAAGAGCCAGCCAGTGCCAGCCAGTCCAGTATTTCAAAATTATAACATTCTCATTCGATTGCAAGCAAGAGGCGTTCTGTGGGCTTCTATGGCTTCTATGCCGACATGGAGTACATTGCCAGATCTTTCACATGTGCGAC

Full Affymetrix probeset data:

Annotations for 1625326_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime