FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625332_at:

>probe:Drosophila_2:1625332_at:266:555; Interrogation_Position=2177; Antisense; GGACGAGAGCGTGGCCAAAGCATTT
>probe:Drosophila_2:1625332_at:172:603; Interrogation_Position=2201; Antisense; TGATATAACTTTTTCTACCGACAAC
>probe:Drosophila_2:1625332_at:121:159; Interrogation_Position=2227; Antisense; ACACAAGCGGATACACTCAGGCGGT
>probe:Drosophila_2:1625332_at:15:667; Interrogation_Position=2238; Antisense; TACACTCAGGCGGTGACGGAGCCAA
>probe:Drosophila_2:1625332_at:283:511; Interrogation_Position=2250; Antisense; GTGACGGAGCCAACTGAGATTACTA
>probe:Drosophila_2:1625332_at:667:491; Interrogation_Position=2321; Antisense; GTAACCGATTCCCACTTGAACAGAT
>probe:Drosophila_2:1625332_at:408:25; Interrogation_Position=2346; Antisense; ATAGACAGATGACTTGGCGTCCAAG
>probe:Drosophila_2:1625332_at:693:119; Interrogation_Position=2413; Antisense; AGCGTAATTATGTGCAGCTTATCAA
>probe:Drosophila_2:1625332_at:67:87; Interrogation_Position=2453; Antisense; AGTGCAGCCCTAATTACTTATTTAA
>probe:Drosophila_2:1625332_at:381:183; Interrogation_Position=2495; Antisense; AAAATCTGTGTTAATGTCCCCGTGT
>probe:Drosophila_2:1625332_at:496:503; Interrogation_Position=2510; Antisense; GTCCCCGTGTTTTTGCTGCGAGAGT
>probe:Drosophila_2:1625332_at:262:501; Interrogation_Position=2533; Antisense; GTCGATATGTGTAAAAGCCCCTGTT
>probe:Drosophila_2:1625332_at:125:483; Interrogation_Position=2617; Antisense; GTATTTTATAGTTACTCACGCGTAG
>probe:Drosophila_2:1625332_at:177:191; Interrogation_Position=2684; Antisense; AACTATCCTAGAACAAGACGAGCCA

Paste this into a BLAST search page for me
GGACGAGAGCGTGGCCAAAGCATTTTGATATAACTTTTTCTACCGACAACACACAAGCGGATACACTCAGGCGGTTACACTCAGGCGGTGACGGAGCCAAGTGACGGAGCCAACTGAGATTACTAGTAACCGATTCCCACTTGAACAGATATAGACAGATGACTTGGCGTCCAAGAGCGTAATTATGTGCAGCTTATCAAAGTGCAGCCCTAATTACTTATTTAAAAAATCTGTGTTAATGTCCCCGTGTGTCCCCGTGTTTTTGCTGCGAGAGTGTCGATATGTGTAAAAGCCCCTGTTGTATTTTATAGTTACTCACGCGTAGAACTATCCTAGAACAAGACGAGCCA

Full Affymetrix probeset data:

Annotations for 1625332_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720