FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625333_at:

>probe:Drosophila_2:1625333_at:62:271; Interrogation_Position=2253; Antisense; CATACAAAGATGTCCACTGGGCATT
>probe:Drosophila_2:1625333_at:98:223; Interrogation_Position=2293; Antisense; AAGGGAATGCTGTTGGTATCCACAA
>probe:Drosophila_2:1625333_at:415:255; Interrogation_Position=2315; Antisense; CAACAAATGGCGAAGTCTACGGTTT
>probe:Drosophila_2:1625333_at:356:1; Interrogation_Position=2329; Antisense; GTCTACGGTTTTGATCGTACCCTAG
>probe:Drosophila_2:1625333_at:251:97; Interrogation_Position=2369; Antisense; AGCTTCAATTGCACGTAACTGGTAT
>probe:Drosophila_2:1625333_at:505:71; Interrogation_Position=2419; Antisense; AGGCATCTTTTACACATTCTATCCG
>probe:Drosophila_2:1625333_at:715:183; Interrogation_Position=2506; Antisense; AAAATCGAGTACTTGGGTCTTCACA
>probe:Drosophila_2:1625333_at:309:531; Interrogation_Position=2520; Antisense; GGGTCTTCACAATGCCCAAGTTAAT
>probe:Drosophila_2:1625333_at:655:233; Interrogation_Position=2542; Antisense; AATGCCCTGGCAATACATTGTCCTA
>probe:Drosophila_2:1625333_at:1:505; Interrogation_Position=2561; Antisense; GTCCTACCAAAAGTGTCGCAGCATC
>probe:Drosophila_2:1625333_at:77:353; Interrogation_Position=2578; Antisense; GCAGCATCCGAATTGTTCGCCTATA
>probe:Drosophila_2:1625333_at:380:471; Interrogation_Position=2592; Antisense; GTTCGCCTATACCTGCAGCATAGAT
>probe:Drosophila_2:1625333_at:137:327; Interrogation_Position=2658; Antisense; GCGAGTTGGTTATACGTGCATAGCA
>probe:Drosophila_2:1625333_at:277:481; Interrogation_Position=2721; Antisense; GTATTTCTACGGATGTGGATTGCAG

Paste this into a BLAST search page for me
CATACAAAGATGTCCACTGGGCATTAAGGGAATGCTGTTGGTATCCACAACAACAAATGGCGAAGTCTACGGTTTGTCTACGGTTTTGATCGTACCCTAGAGCTTCAATTGCACGTAACTGGTATAGGCATCTTTTACACATTCTATCCGAAAATCGAGTACTTGGGTCTTCACAGGGTCTTCACAATGCCCAAGTTAATAATGCCCTGGCAATACATTGTCCTAGTCCTACCAAAAGTGTCGCAGCATCGCAGCATCCGAATTGTTCGCCTATAGTTCGCCTATACCTGCAGCATAGATGCGAGTTGGTTATACGTGCATAGCAGTATTTCTACGGATGTGGATTGCAG

Full Affymetrix probeset data:

Annotations for 1625333_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720