FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625334_at:

>probe:Drosophila_2:1625334_at:159:489; Interrogation_Position=119; Antisense; GTACGCGGTAATTGCCTGTGCTGCA
>probe:Drosophila_2:1625334_at:379:123; Interrogation_Position=161; Antisense; AGCCCTCGAGTTCAGCGATTGCGGA
>probe:Drosophila_2:1625334_at:130:127; Interrogation_Position=234; Antisense; ACCAAGGCGGAGTGCATCCTCAAGA
>probe:Drosophila_2:1625334_at:522:213; Interrogation_Position=255; Antisense; AAGAGGAACACCACGGTCAGCTTCT
>probe:Drosophila_2:1625334_at:699:611; Interrogation_Position=316; Antisense; TGAAGACAGTCGTCCACGGCAAGGT
>probe:Drosophila_2:1625334_at:154:251; Interrogation_Position=371; Antisense; CAATCCCGATGCCTGTGTGGACAGT
>probe:Drosophila_2:1625334_at:658:153; Interrogation_Position=391; Antisense; ACAGTGGTCTGAAGTGCCCGTTGGA
>probe:Drosophila_2:1625334_at:669:223; Interrogation_Position=417; Antisense; AAGGACGAGTCGTACCGCTACACGG
>probe:Drosophila_2:1625334_at:26:509; Interrogation_Position=453; Antisense; GTGCTGAGATCCTACCCCAAAGTGT
>probe:Drosophila_2:1625334_at:640:255; Interrogation_Position=470; Antisense; CAAAGTGTCCGTGCTGGTCAAGTGG
>probe:Drosophila_2:1625334_at:394:75; Interrogation_Position=508; Antisense; AGGACGGAGCGGACATCATCTGCGT
>probe:Drosophila_2:1625334_at:15:41; Interrogation_Position=525; Antisense; ATCTGCGTCGAGATTCCCGCTAAAA
>probe:Drosophila_2:1625334_at:163:163; Interrogation_Position=547; Antisense; AAATTCAGTAGGCAGTCACCCTCTA
>probe:Drosophila_2:1625334_at:466:425; Interrogation_Position=593; Antisense; GAGAGCGCACTGAGCACTCCTGATT

Paste this into a BLAST search page for me
GTACGCGGTAATTGCCTGTGCTGCAAGCCCTCGAGTTCAGCGATTGCGGAACCAAGGCGGAGTGCATCCTCAAGAAAGAGGAACACCACGGTCAGCTTCTTGAAGACAGTCGTCCACGGCAAGGTCAATCCCGATGCCTGTGTGGACAGTACAGTGGTCTGAAGTGCCCGTTGGAAAGGACGAGTCGTACCGCTACACGGGTGCTGAGATCCTACCCCAAAGTGTCAAAGTGTCCGTGCTGGTCAAGTGGAGGACGGAGCGGACATCATCTGCGTATCTGCGTCGAGATTCCCGCTAAAAAAATTCAGTAGGCAGTCACCCTCTAGAGAGCGCACTGAGCACTCCTGATT

Full Affymetrix probeset data:

Annotations for 1625334_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720