Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625335_at:

>probe:Drosophila_2:1625335_at:110:719; Interrogation_Position=2754; Antisense; TTCCTCTTCAGCAGGTCAGTAGACG
>probe:Drosophila_2:1625335_at:261:533; Interrogation_Position=2793; Antisense; GGTGGCGGTCGTAGTCTGCTCAACT
>probe:Drosophila_2:1625335_at:662:485; Interrogation_Position=2803; Antisense; GTAGTCTGCTCAACTCGCTGCACAG
>probe:Drosophila_2:1625335_at:423:313; Interrogation_Position=2830; Antisense; GCCTTGCCAAGCTCATTTGAACTCA
>probe:Drosophila_2:1625335_at:521:381; Interrogation_Position=2848; Antisense; GAACTCAGAACTCAGAAATCGGATT
>probe:Drosophila_2:1625335_at:491:461; Interrogation_Position=2875; Antisense; GATTCCGAAACCGAATTTGAATTTG
>probe:Drosophila_2:1625335_at:351:583; Interrogation_Position=2929; Antisense; TGTATACCCGAACCGAAACAGCGAT
>probe:Drosophila_2:1625335_at:89:391; Interrogation_Position=2943; Antisense; GAAACAGCGATGATCAGCGCAATTT
>probe:Drosophila_2:1625335_at:279:123; Interrogation_Position=2958; Antisense; AGCGCAATTTTTGCACCCATCTAAT
>probe:Drosophila_2:1625335_at:681:699; Interrogation_Position=2966; Antisense; TTTTGCACCCATCTAATCCAACCAA
>probe:Drosophila_2:1625335_at:344:23; Interrogation_Position=3068; Antisense; ATATGAACGAATTGGCTGCTTTGAT
>probe:Drosophila_2:1625335_at:123:249; Interrogation_Position=3077; Antisense; AATTGGCTGCTTTGATTTGGTCTCT
>probe:Drosophila_2:1625335_at:415:691; Interrogation_Position=3087; Antisense; TTTGATTTGGTCTCTGCTTTTGCTA
>probe:Drosophila_2:1625335_at:17:343; Interrogation_Position=3102; Antisense; GCTTTTGCTACTTTCAATCTCACAA

Paste this into a BLAST search page for me
TTCCTCTTCAGCAGGTCAGTAGACGGGTGGCGGTCGTAGTCTGCTCAACTGTAGTCTGCTCAACTCGCTGCACAGGCCTTGCCAAGCTCATTTGAACTCAGAACTCAGAACTCAGAAATCGGATTGATTCCGAAACCGAATTTGAATTTGTGTATACCCGAACCGAAACAGCGATGAAACAGCGATGATCAGCGCAATTTAGCGCAATTTTTGCACCCATCTAATTTTTGCACCCATCTAATCCAACCAAATATGAACGAATTGGCTGCTTTGATAATTGGCTGCTTTGATTTGGTCTCTTTTGATTTGGTCTCTGCTTTTGCTAGCTTTTGCTACTTTCAATCTCACAA

Full Affymetrix probeset data:

Annotations for 1625335_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime