Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625337_s_at:

>probe:Drosophila_2:1625337_s_at:191:89; Interrogation_Position=112; Antisense; AGTCGGATCGATATGCTAAGCTGTC
>probe:Drosophila_2:1625337_s_at:500:199; Interrogation_Position=150; Antisense; AAGCCCAAGGGTATCGACAACAGAG
>probe:Drosophila_2:1625337_s_at:404:159; Interrogation_Position=166; Antisense; ACAACAGAGTGCGTCGCCGCTTCAA
>probe:Drosophila_2:1625337_s_at:689:319; Interrogation_Position=181; Antisense; GCCGCTTCAAGGGACAGTATCTGAT
>probe:Drosophila_2:1625337_s_at:318:443; Interrogation_Position=203; Antisense; GATGCCCAACATCGGTTACGGATCG
>probe:Drosophila_2:1625337_s_at:476:621; Interrogation_Position=247; Antisense; TGCTGCCCACCGGATTCAAGAAGTT
>probe:Drosophila_2:1625337_s_at:421:107; Interrogation_Position=265; Antisense; AGAAGTTCCTGGTGCACAACGTGCG
>probe:Drosophila_2:1625337_s_at:592:159; Interrogation_Position=280; Antisense; ACAACGTGCGCGAGCTGGAGGTCCT
>probe:Drosophila_2:1625337_s_at:111:121; Interrogation_Position=292; Antisense; AGCTGGAGGTCCTGCTCATGCAGAA
>probe:Drosophila_2:1625337_s_at:726:107; Interrogation_Position=313; Antisense; AGAACCGCGTTTACTGCGGCGAGAT
>probe:Drosophila_2:1625337_s_at:362:141; Interrogation_Position=418; Antisense; ACGGTCGCCTGCGTTCTCAAGAGAA
>probe:Drosophila_2:1625337_s_at:644:97; Interrogation_Position=464; Antisense; AGAGTTCTTGTAACGTGGTCGGAAT
>probe:Drosophila_2:1625337_s_at:363:327; Interrogation_Position=538; Antisense; GCGAGTGCCGAGTTCAATTGTCATT
>probe:Drosophila_2:1625337_s_at:371:271; Interrogation_Position=61; Antisense; CATACAGGCCCAAGATCGTGAAGAA

Paste this into a BLAST search page for me
AGTCGGATCGATATGCTAAGCTGTCAAGCCCAAGGGTATCGACAACAGAGACAACAGAGTGCGTCGCCGCTTCAAGCCGCTTCAAGGGACAGTATCTGATGATGCCCAACATCGGTTACGGATCGTGCTGCCCACCGGATTCAAGAAGTTAGAAGTTCCTGGTGCACAACGTGCGACAACGTGCGCGAGCTGGAGGTCCTAGCTGGAGGTCCTGCTCATGCAGAAAGAACCGCGTTTACTGCGGCGAGATACGGTCGCCTGCGTTCTCAAGAGAAAGAGTTCTTGTAACGTGGTCGGAATGCGAGTGCCGAGTTCAATTGTCATTCATACAGGCCCAAGATCGTGAAGAA

Full Affymetrix probeset data:

Annotations for 1625337_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime