FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625338_at:

>probe:Drosophila_2:1625338_at:379:73; Interrogation_Position=1239; Antisense; AGGACCTAAAGTACCTGGACTGCGT
>probe:Drosophila_2:1625338_at:367:33; Interrogation_Position=1265; Antisense; ATCAAGGAGACCATGCGACTGTATC
>probe:Drosophila_2:1625338_at:585:305; Interrogation_Position=1302; Antisense; CCATCGGTAGGCACGCGCAGAAGGA
>probe:Drosophila_2:1625338_at:598:205; Interrogation_Position=1363; Antisense; AAGCATTTACCTGGTTCTCTACTAC
>probe:Drosophila_2:1625338_at:413:291; Interrogation_Position=1394; Antisense; CGGGATGCGAACTACTTTCCAGATC
>probe:Drosophila_2:1625338_at:520:313; Interrogation_Position=1432; Antisense; GCCAGAGCGATTCTTGGAGGACCAA
>probe:Drosophila_2:1625338_at:418:67; Interrogation_Position=1462; Antisense; AGGCCACAATACCTTTGCCTATGTG
>probe:Drosophila_2:1625338_at:567:83; Interrogation_Position=1493; Antisense; AGTGCGGGACCCAAGAACTGCATTG
>probe:Drosophila_2:1625338_at:21:223; Interrogation_Position=1544; Antisense; AAGGTCCTGATCAGCAAGGTCCTCA
>probe:Drosophila_2:1625338_at:600:223; Interrogation_Position=1559; Antisense; AAGGTCCTCAGGTTCTATGAACTGC
>probe:Drosophila_2:1625338_at:632:335; Interrogation_Position=1582; Antisense; GCTGCCCCTTGGAGAGGAGCTCAAA
>probe:Drosophila_2:1625338_at:116:177; Interrogation_Position=1604; Antisense; AAACCCATGTTGAACTTCATCCTGC
>probe:Drosophila_2:1625338_at:522:283; Interrogation_Position=1625; Antisense; CTGCGCTCAGCTTCGGGCATTAATG
>probe:Drosophila_2:1625338_at:242:569; Interrogation_Position=1669; Antisense; GGCATTGCGTTGAGGTTTCGGTTTA

Paste this into a BLAST search page for me
AGGACCTAAAGTACCTGGACTGCGTATCAAGGAGACCATGCGACTGTATCCCATCGGTAGGCACGCGCAGAAGGAAAGCATTTACCTGGTTCTCTACTACCGGGATGCGAACTACTTTCCAGATCGCCAGAGCGATTCTTGGAGGACCAAAGGCCACAATACCTTTGCCTATGTGAGTGCGGGACCCAAGAACTGCATTGAAGGTCCTGATCAGCAAGGTCCTCAAAGGTCCTCAGGTTCTATGAACTGCGCTGCCCCTTGGAGAGGAGCTCAAAAAACCCATGTTGAACTTCATCCTGCCTGCGCTCAGCTTCGGGCATTAATGGGCATTGCGTTGAGGTTTCGGTTTA

Full Affymetrix probeset data:

Annotations for 1625338_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720