FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625339_at:

>probe:Drosophila_2:1625339_at:377:163; Interrogation_Position=113; Antisense; AAATTAACGCTCGAGATGGGATTCA
>probe:Drosophila_2:1625339_at:499:231; Interrogation_Position=138; Antisense; AATGAATAAGGCTCCTGGCCAGAAT
>probe:Drosophila_2:1625339_at:265:691; Interrogation_Position=167; Antisense; TATTGATGTTATCCCCAGCTAGACC
>probe:Drosophila_2:1625339_at:620:117; Interrogation_Position=183; Antisense; AGCTAGACCAGTTAGCTGCCGACGT
>probe:Drosophila_2:1625339_at:440:335; Interrogation_Position=197; Antisense; GCTGCCGACGTTGTGTGGTTATCAA
>probe:Drosophila_2:1625339_at:710:579; Interrogation_Position=224; Antisense; TGGCCAATATTCCAATCCACAGCAC
>probe:Drosophila_2:1625339_at:231:153; Interrogation_Position=247; Antisense; ACATCCGCACATCAGCTGAGATACA
>probe:Drosophila_2:1625339_at:500:415; Interrogation_Position=274; Antisense; GAGCCACACTCGCATATTGTATCTG
>probe:Drosophila_2:1625339_at:435:525; Interrogation_Position=334; Antisense; GGGAAAACGCCAGCTGAAACTATCA
>probe:Drosophila_2:1625339_at:432:173; Interrogation_Position=385; Antisense; AAAGCAGGCAACACGAGCTGCCGCA
>probe:Drosophila_2:1625339_at:262:369; Interrogation_Position=486; Antisense; GAATGCTAACTTCAGGCAGCCAAAA
>probe:Drosophila_2:1625339_at:596:197; Interrogation_Position=530; Antisense; AACGGGCGAAATTTGCATGCATATT
>probe:Drosophila_2:1625339_at:213:433; Interrogation_Position=62; Antisense; GAGTGCAACAGGGACTCGACTCTGT
>probe:Drosophila_2:1625339_at:682:635; Interrogation_Position=77; Antisense; TCGACTCTGTGGTGCCTTGTGGCAT

Paste this into a BLAST search page for me
AAATTAACGCTCGAGATGGGATTCAAATGAATAAGGCTCCTGGCCAGAATTATTGATGTTATCCCCAGCTAGACCAGCTAGACCAGTTAGCTGCCGACGTGCTGCCGACGTTGTGTGGTTATCAATGGCCAATATTCCAATCCACAGCACACATCCGCACATCAGCTGAGATACAGAGCCACACTCGCATATTGTATCTGGGGAAAACGCCAGCTGAAACTATCAAAAGCAGGCAACACGAGCTGCCGCAGAATGCTAACTTCAGGCAGCCAAAAAACGGGCGAAATTTGCATGCATATTGAGTGCAACAGGGACTCGACTCTGTTCGACTCTGTGGTGCCTTGTGGCAT

Full Affymetrix probeset data:

Annotations for 1625339_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720