Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625340_at:

>probe:Drosophila_2:1625340_at:639:427; Interrogation_Position=2173; Antisense; GAGATCAAACGCCTTGACGGTCCTA
>probe:Drosophila_2:1625340_at:205:135; Interrogation_Position=2181; Antisense; ACGCCTTGACGGTCCTATAAACGAG
>probe:Drosophila_2:1625340_at:557:405; Interrogation_Position=2188; Antisense; GACGGTCCTATAAACGAGATTACTT
>probe:Drosophila_2:1625340_at:684:427; Interrogation_Position=2203; Antisense; GAGATTACTTCAAACTTCAGCCCAC
>probe:Drosophila_2:1625340_at:653:177; Interrogation_Position=2214; Antisense; AAACTTCAGCCCACCAGATTTGGAT
>probe:Drosophila_2:1625340_at:400:261; Interrogation_Position=2220; Antisense; CAGCCCACCAGATTTGGATTCGGAT
>probe:Drosophila_2:1625340_at:184:543; Interrogation_Position=2235; Antisense; GGATTCGGATATAATTTTAGTGGCA
>probe:Drosophila_2:1625340_at:283:245; Interrogation_Position=2247; Antisense; AATTTTAGTGGCATTCGTATTGGAA
>probe:Drosophila_2:1625340_at:534:569; Interrogation_Position=2256; Antisense; GGCATTCGTATTGGAAGAGTTCTCA
>probe:Drosophila_2:1625340_at:507:563; Interrogation_Position=2268; Antisense; GGAAGAGTTCTCATCTCACGTGTTT
>probe:Drosophila_2:1625340_at:459:93; Interrogation_Position=2273; Antisense; AGTTCTCATCTCACGTGTTTTATAC
>probe:Drosophila_2:1625340_at:408:269; Interrogation_Position=2279; Antisense; CATCTCACGTGTTTTATACGAAAAT
>probe:Drosophila_2:1625340_at:460:391; Interrogation_Position=2328; Antisense; GAAACGCACACAGCTTAATGCTCGA
>probe:Drosophila_2:1625340_at:445:357; Interrogation_Position=2333; Antisense; GCACACAGCTTAATGCTCGATCAAA

Paste this into a BLAST search page for me
GAGATCAAACGCCTTGACGGTCCTAACGCCTTGACGGTCCTATAAACGAGGACGGTCCTATAAACGAGATTACTTGAGATTACTTCAAACTTCAGCCCACAAACTTCAGCCCACCAGATTTGGATCAGCCCACCAGATTTGGATTCGGATGGATTCGGATATAATTTTAGTGGCAAATTTTAGTGGCATTCGTATTGGAAGGCATTCGTATTGGAAGAGTTCTCAGGAAGAGTTCTCATCTCACGTGTTTAGTTCTCATCTCACGTGTTTTATACCATCTCACGTGTTTTATACGAAAATGAAACGCACACAGCTTAATGCTCGAGCACACAGCTTAATGCTCGATCAAA

Full Affymetrix probeset data:

Annotations for 1625340_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime