FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625342_at:

>probe:Drosophila_2:1625342_at:520:5; Interrogation_Position=2108; Antisense; ATTGTCCTAAGCTTGGGCTACCAGT
>probe:Drosophila_2:1625342_at:204:531; Interrogation_Position=2139; Antisense; GGGTTTTCAGCTTCATCAACTATAT
>probe:Drosophila_2:1625342_at:290:21; Interrogation_Position=2171; Antisense; ATATTCAAAGCATCCGGCTCGGTTG
>probe:Drosophila_2:1625342_at:436:585; Interrogation_Position=2196; Antisense; TGGACGTTAATACGGCCACCATTAT
>probe:Drosophila_2:1625342_at:560:679; Interrogation_Position=2229; Antisense; TAGTCCAGATCGTTGGCGTCTACAC
>probe:Drosophila_2:1625342_at:579:81; Interrogation_Position=2285; Antisense; AGGGTTCTGATGTTGATCTCCACTA
>probe:Drosophila_2:1625342_at:162:469; Interrogation_Position=2340; Antisense; GTTGCTTCACCTACTTGGCCAAAAT
>probe:Drosophila_2:1625342_at:38:655; Interrogation_Position=2383; Antisense; TAATTGGCTTCCTTTGGTGCTGATG
>probe:Drosophila_2:1625342_at:432:465; Interrogation_Position=2440; Antisense; GATTGGAATCTTTTTCCTCGTGCTG
>probe:Drosophila_2:1625342_at:484:479; Interrogation_Position=2473; Antisense; GTTTCCAGTAAAGATTCGCTCCCTA
>probe:Drosophila_2:1625342_at:250:689; Interrogation_Position=2527; Antisense; TTTACTCGTCTTTGGAACCCTGAAG
>probe:Drosophila_2:1625342_at:541:525; Interrogation_Position=2578; Antisense; GGGCATATCCTTTACCATGTGGTTC
>probe:Drosophila_2:1625342_at:549:145; Interrogation_Position=2617; Antisense; ACTACTTACGTTCTTCTACTTCTGG
>probe:Drosophila_2:1625342_at:122:669; Interrogation_Position=2633; Antisense; TACTTCTGGCTCTTCCTGCAGGAAA

Paste this into a BLAST search page for me
ATTGTCCTAAGCTTGGGCTACCAGTGGGTTTTCAGCTTCATCAACTATATATATTCAAAGCATCCGGCTCGGTTGTGGACGTTAATACGGCCACCATTATTAGTCCAGATCGTTGGCGTCTACACAGGGTTCTGATGTTGATCTCCACTAGTTGCTTCACCTACTTGGCCAAAATTAATTGGCTTCCTTTGGTGCTGATGGATTGGAATCTTTTTCCTCGTGCTGGTTTCCAGTAAAGATTCGCTCCCTATTTACTCGTCTTTGGAACCCTGAAGGGGCATATCCTTTACCATGTGGTTCACTACTTACGTTCTTCTACTTCTGGTACTTCTGGCTCTTCCTGCAGGAAA

Full Affymetrix probeset data:

Annotations for 1625342_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720