FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625344_at:

>probe:Drosophila_2:1625344_at:456:389; Interrogation_Position=1050; Antisense; GAAAAAGACATTCCGTCCTGGCCAC
>probe:Drosophila_2:1625344_at:285:655; Interrogation_Position=1079; Antisense; TAATCCACATCCTACCCGAGGTGTC
>probe:Drosophila_2:1625344_at:436:435; Interrogation_Position=1096; Antisense; GAGGTGTCCACCGAGAAGTACAAGA
>probe:Drosophila_2:1625344_at:622:621; Interrogation_Position=1136; Antisense; TGCTGATCGACGAATGCCAGTCCAT
>probe:Drosophila_2:1625344_at:8:625; Interrogation_Position=1150; Antisense; TGCCAGTCCATCATGCAGACGGAGT
>probe:Drosophila_2:1625344_at:694:407; Interrogation_Position=1167; Antisense; GACGGAGTACACAAAGCTGAGCAAA
>probe:Drosophila_2:1625344_at:339:371; Interrogation_Position=1192; Antisense; GAAGGCCAAGCCTTGAGCTCAAAGA
>probe:Drosophila_2:1625344_at:681:455; Interrogation_Position=1233; Antisense; GATAGGTTACGATCAAACTCAGGTT
>probe:Drosophila_2:1625344_at:176:291; Interrogation_Position=1301; Antisense; CGATCCACAAGATTTGCCTATCCAT
>probe:Drosophila_2:1625344_at:590:187; Interrogation_Position=1346; Antisense; AACAGAATGCCGTTACTTGAGGGAC
>probe:Drosophila_2:1625344_at:308:93; Interrogation_Position=1394; Antisense; AGTTACACAATATCACTCCATGGGT
>probe:Drosophila_2:1625344_at:367:145; Interrogation_Position=1408; Antisense; ACTCCATGGGTGAATTTTCGATTAA
>probe:Drosophila_2:1625344_at:338:661; Interrogation_Position=1436; Antisense; TAACTGTTTTACCTCCAGTACATGC
>probe:Drosophila_2:1625344_at:19:681; Interrogation_Position=1466; Antisense; TATGCCCAGAGCTTTTTTCGACTAA

Paste this into a BLAST search page for me
GAAAAAGACATTCCGTCCTGGCCACTAATCCACATCCTACCCGAGGTGTCGAGGTGTCCACCGAGAAGTACAAGATGCTGATCGACGAATGCCAGTCCATTGCCAGTCCATCATGCAGACGGAGTGACGGAGTACACAAAGCTGAGCAAAGAAGGCCAAGCCTTGAGCTCAAAGAGATAGGTTACGATCAAACTCAGGTTCGATCCACAAGATTTGCCTATCCATAACAGAATGCCGTTACTTGAGGGACAGTTACACAATATCACTCCATGGGTACTCCATGGGTGAATTTTCGATTAATAACTGTTTTACCTCCAGTACATGCTATGCCCAGAGCTTTTTTCGACTAA

Full Affymetrix probeset data:

Annotations for 1625344_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720