FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625347_at:

>probe:Drosophila_2:1625347_at:449:59; Interrogation_Position=13; Antisense; ATGTTAGTAGCTGCTCCAGTTGGCC
>probe:Drosophila_2:1625347_at:476:531; Interrogation_Position=156; Antisense; GGTCTGGCGCAGTTTGGTCTACTAC
>probe:Drosophila_2:1625347_at:252:537; Interrogation_Position=171; Antisense; GGTCTACTACTATGTGCTGCATTTC
>probe:Drosophila_2:1625347_at:691:21; Interrogation_Position=250; Antisense; ATATATGCGCGTTCGTTGCAGGAGA
>probe:Drosophila_2:1625347_at:96:293; Interrogation_Position=321; Antisense; CGTATATGCCGCCTTGGAGAACTAT
>probe:Drosophila_2:1625347_at:329:651; Interrogation_Position=381; Antisense; TCACTGTTTGCTGCGAGGGATCTGT
>probe:Drosophila_2:1625347_at:215:81; Interrogation_Position=416; Antisense; AGGTGCATCACCATGTGGGCATCAT
>probe:Drosophila_2:1625347_at:549:67; Interrogation_Position=439; Antisense; ATGGCGGAGCTACTAGTCGTTCTAC
>probe:Drosophila_2:1625347_at:213:499; Interrogation_Position=454; Antisense; GTCGTTCTACTCACACCTGGTAAAA
>probe:Drosophila_2:1625347_at:402:141; Interrogation_Position=46; Antisense; ACGGAGTATATGCATGCGCGCCAGA
>probe:Drosophila_2:1625347_at:167:183; Interrogation_Position=475; Antisense; AAAACGCGCTTGGATGTGGCCTACA
>probe:Drosophila_2:1625347_at:176:565; Interrogation_Position=526; Antisense; GGAATCGATTGCCTAGCTCGCTATT
>probe:Drosophila_2:1625347_at:499:673; Interrogation_Position=539; Antisense; TAGCTCGCTATTCGGATTGTCCAAG
>probe:Drosophila_2:1625347_at:173:439; Interrogation_Position=72; Antisense; GAGGCATCAGTTGATCTACCGGAAT

Paste this into a BLAST search page for me
ATGTTAGTAGCTGCTCCAGTTGGCCGGTCTGGCGCAGTTTGGTCTACTACGGTCTACTACTATGTGCTGCATTTCATATATGCGCGTTCGTTGCAGGAGACGTATATGCCGCCTTGGAGAACTATTCACTGTTTGCTGCGAGGGATCTGTAGGTGCATCACCATGTGGGCATCATATGGCGGAGCTACTAGTCGTTCTACGTCGTTCTACTCACACCTGGTAAAAACGGAGTATATGCATGCGCGCCAGAAAAACGCGCTTGGATGTGGCCTACAGGAATCGATTGCCTAGCTCGCTATTTAGCTCGCTATTCGGATTGTCCAAGGAGGCATCAGTTGATCTACCGGAAT

Full Affymetrix probeset data:

Annotations for 1625347_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720