Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625349_at:

>probe:Drosophila_2:1625349_at:188:645; Interrogation_Position=1258; Antisense; TCTTACCGGGAATTATTTGTGACCA
>probe:Drosophila_2:1625349_at:349:691; Interrogation_Position=1273; Antisense; TTTGTGACCAAAATCTTATCGCTCT
>probe:Drosophila_2:1625349_at:241:513; Interrogation_Position=1276; Antisense; GTGACCAAAATCTTATCGCTCTTGT
>probe:Drosophila_2:1625349_at:421:413; Interrogation_Position=1278; Antisense; GACCAAAATCTTATCGCTCTTGTTC
>probe:Drosophila_2:1625349_at:618:183; Interrogation_Position=1282; Antisense; AAAATCTTATCGCTCTTGTTCGTCC
>probe:Drosophila_2:1625349_at:309:239; Interrogation_Position=1284; Antisense; AATCTTATCGCTCTTGTTCGTCCAA
>probe:Drosophila_2:1625349_at:717:37; Interrogation_Position=1285; Antisense; ATCTTATCGCTCTTGTTCGTCCAAC
>probe:Drosophila_2:1625349_at:200:705; Interrogation_Position=1288; Antisense; TTATCGCTCTTGTTCGTCCAACCAA
>probe:Drosophila_2:1625349_at:405:43; Interrogation_Position=1290; Antisense; ATCGCTCTTGTTCGTCCAACCAAAT
>probe:Drosophila_2:1625349_at:429:321; Interrogation_Position=1293; Antisense; GCTCTTGTTCGTCCAACCAAATGCA
>probe:Drosophila_2:1625349_at:726:641; Interrogation_Position=1295; Antisense; TCTTGTTCGTCCAACCAAATGCAGC
>probe:Drosophila_2:1625349_at:674:723; Interrogation_Position=1297; Antisense; TTGTTCGTCCAACCAAATGCAGCCA
>probe:Drosophila_2:1625349_at:324:471; Interrogation_Position=1299; Antisense; GTTCGTCCAACCAAATGCAGCCAGT
>probe:Drosophila_2:1625349_at:303:637; Interrogation_Position=1301; Antisense; TCGTCCAACCAAATGCAGCCAGTTC

Paste this into a BLAST search page for me
TCTTACCGGGAATTATTTGTGACCATTTGTGACCAAAATCTTATCGCTCTGTGACCAAAATCTTATCGCTCTTGTGACCAAAATCTTATCGCTCTTGTTCAAAATCTTATCGCTCTTGTTCGTCCAATCTTATCGCTCTTGTTCGTCCAAATCTTATCGCTCTTGTTCGTCCAACTTATCGCTCTTGTTCGTCCAACCAAATCGCTCTTGTTCGTCCAACCAAATGCTCTTGTTCGTCCAACCAAATGCATCTTGTTCGTCCAACCAAATGCAGCTTGTTCGTCCAACCAAATGCAGCCAGTTCGTCCAACCAAATGCAGCCAGTTCGTCCAACCAAATGCAGCCAGTTC

Full Affymetrix probeset data:

Annotations for 1625349_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime