Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625351_at:

>probe:Drosophila_2:1625351_at:235:601; Interrogation_Position=1801; Antisense; TGTACGCAAAACCAATCCTCAACTA
>probe:Drosophila_2:1625351_at:567:191; Interrogation_Position=1821; Antisense; AACTACGTTCACAACCTGGCATCTA
>probe:Drosophila_2:1625351_at:271:631; Interrogation_Position=1883; Antisense; TCCTGCATCTTTATCATCACATTTC
>probe:Drosophila_2:1625351_at:487:151; Interrogation_Position=1901; Antisense; ACATTTCATATCCTTCTGCTTCATA
>probe:Drosophila_2:1625351_at:300:709; Interrogation_Position=1936; Antisense; TTAAGCTTGCACAGCACTCGAGGCT
>probe:Drosophila_2:1625351_at:602:115; Interrogation_Position=1964; Antisense; AGCATGTAGTCCTGTGCGTTGCACA
>probe:Drosophila_2:1625351_at:386:415; Interrogation_Position=2019; Antisense; GAGCCCCGCAATTTGGTTTTACTGT
>probe:Drosophila_2:1625351_at:395:511; Interrogation_Position=2046; Antisense; GTGACCTACGTCTGCGAAACAGCGG
>probe:Drosophila_2:1625351_at:298:187; Interrogation_Position=2063; Antisense; AACAGCGGTCCGTGTGATCCTCGAT
>probe:Drosophila_2:1625351_at:556:707; Interrogation_Position=2101; Antisense; TTAAAGGCACGCAATCTTCGATCCG
>probe:Drosophila_2:1625351_at:470:407; Interrogation_Position=2190; Antisense; GACGGTTTAGTCGATATGCTGCCTC
>probe:Drosophila_2:1625351_at:397:21; Interrogation_Position=2221; Antisense; ATATTTCGTTGCCTGATGTTCCCTT
>probe:Drosophila_2:1625351_at:663:441; Interrogation_Position=2235; Antisense; GATGTTCCCTTCAGCGTTAAAACAA
>probe:Drosophila_2:1625351_at:189:169; Interrogation_Position=2348; Antisense; AAATGGCTTCCGCTAATTGGTATGA

Paste this into a BLAST search page for me
TGTACGCAAAACCAATCCTCAACTAAACTACGTTCACAACCTGGCATCTATCCTGCATCTTTATCATCACATTTCACATTTCATATCCTTCTGCTTCATATTAAGCTTGCACAGCACTCGAGGCTAGCATGTAGTCCTGTGCGTTGCACAGAGCCCCGCAATTTGGTTTTACTGTGTGACCTACGTCTGCGAAACAGCGGAACAGCGGTCCGTGTGATCCTCGATTTAAAGGCACGCAATCTTCGATCCGGACGGTTTAGTCGATATGCTGCCTCATATTTCGTTGCCTGATGTTCCCTTGATGTTCCCTTCAGCGTTAAAACAAAAATGGCTTCCGCTAATTGGTATGA

Full Affymetrix probeset data:

Annotations for 1625351_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime