FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625353_at:

>probe:Drosophila_2:1625353_at:612:285; Interrogation_Position=115; Antisense; CTGGCTCTGGTCGTCCTGGATATAT
>probe:Drosophila_2:1625353_at:69:287; Interrogation_Position=154; Antisense; CTGGCTGCGGGCATTAGTTATAGCA
>probe:Drosophila_2:1625353_at:494:289; Interrogation_Position=186; Antisense; CGGCAACCTGAGCACTTCGCAAAAG
>probe:Drosophila_2:1625353_at:133:171; Interrogation_Position=207; Antisense; AAAGAGTCCCTCGTCGGCGAATAAT
>probe:Drosophila_2:1625353_at:419:421; Interrogation_Position=360; Antisense; GAGCACCAGCGGATCCAATAGCAAC
>probe:Drosophila_2:1625353_at:244:27; Interrogation_Position=377; Antisense; ATAGCAACCGCAGTAGTAGACCCAC
>probe:Drosophila_2:1625353_at:668:279; Interrogation_Position=429; Antisense; CTACAGCCCGAACCATGATCAATTA
>probe:Drosophila_2:1625353_at:513:337; Interrogation_Position=462; Antisense; GCTCTCGTCGCGGATTATCAACACA
>probe:Drosophila_2:1625353_at:667:461; Interrogation_Position=474; Antisense; GATTATCAACACACGCAATGGCGCC
>probe:Drosophila_2:1625353_at:206:315; Interrogation_Position=496; Antisense; GCCATCTCAGGCGTAATTGTCCAAT
>probe:Drosophila_2:1625353_at:212:303; Interrogation_Position=577; Antisense; CCGCCGGTCGGCAATTTGAGATTCA
>probe:Drosophila_2:1625353_at:386:243; Interrogation_Position=589; Antisense; AATTTGAGATTCATGCCGCCCGTCT
>probe:Drosophila_2:1625353_at:265:333; Interrogation_Position=616; Antisense; GCGGCCATGTGGTCAGGTGTCAAAA
>probe:Drosophila_2:1625353_at:56:141; Interrogation_Position=94; Antisense; ACGTGGGCGTTGTCATCTCTGCTGG

Paste this into a BLAST search page for me
CTGGCTCTGGTCGTCCTGGATATATCTGGCTGCGGGCATTAGTTATAGCACGGCAACCTGAGCACTTCGCAAAAGAAAGAGTCCCTCGTCGGCGAATAATGAGCACCAGCGGATCCAATAGCAACATAGCAACCGCAGTAGTAGACCCACCTACAGCCCGAACCATGATCAATTAGCTCTCGTCGCGGATTATCAACACAGATTATCAACACACGCAATGGCGCCGCCATCTCAGGCGTAATTGTCCAATCCGCCGGTCGGCAATTTGAGATTCAAATTTGAGATTCATGCCGCCCGTCTGCGGCCATGTGGTCAGGTGTCAAAAACGTGGGCGTTGTCATCTCTGCTGG

Full Affymetrix probeset data:

Annotations for 1625353_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720