FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625354_at:

>probe:Drosophila_2:1625354_at:703:75; Interrogation_Position=1236; Antisense; AGGAGACCCACTTTGGCGGTAATGA
>probe:Drosophila_2:1625354_at:216:331; Interrogation_Position=1251; Antisense; GCGGTAATGATCCTTCTGCCATGTC
>probe:Drosophila_2:1625354_at:440:627; Interrogation_Position=1267; Antisense; TGCCATGTCGCCAGAGTCCTTAAAA
>probe:Drosophila_2:1625354_at:424:727; Interrogation_Position=1324; Antisense; TTGGCATCCCATTCTTAAAACGCTG
>probe:Drosophila_2:1625354_at:251:449; Interrogation_Position=1350; Antisense; GATCCCGTGTAAAGAGCTCCAGTGC
>probe:Drosophila_2:1625354_at:198:683; Interrogation_Position=1388; Antisense; TATCGATTCGATTTTGACTCTCCCA
>probe:Drosophila_2:1625354_at:511:637; Interrogation_Position=1470; Antisense; TCGATGATCACTCCTACCTGTGGTA
>probe:Drosophila_2:1625354_at:354:595; Interrogation_Position=1488; Antisense; TGTGGTACGGCGACTTCTCCTGGAA
>probe:Drosophila_2:1625354_at:501:601; Interrogation_Position=1563; Antisense; TGTTGACAAGCTTCGCGAGGACATC
>probe:Drosophila_2:1625354_at:1:655; Interrogation_Position=1594; Antisense; TAATTGCAAGCTCATCCAGGATCAG
>probe:Drosophila_2:1625354_at:461:33; Interrogation_Position=1614; Antisense; ATCAGCTTCCGCGAGCCAAAGAATG
>probe:Drosophila_2:1625354_at:638:111; Interrogation_Position=1652; Antisense; AGCAAATCCGCTTTGGAGTGCCTCA
>probe:Drosophila_2:1625354_at:208:433; Interrogation_Position=1667; Antisense; GAGTGCCTCAACATCTCGGAGAACA
>probe:Drosophila_2:1625354_at:115:85; Interrogation_Position=1739; Antisense; AGTGTCTGCCAATCAACGGGCTAGT

Paste this into a BLAST search page for me
AGGAGACCCACTTTGGCGGTAATGAGCGGTAATGATCCTTCTGCCATGTCTGCCATGTCGCCAGAGTCCTTAAAATTGGCATCCCATTCTTAAAACGCTGGATCCCGTGTAAAGAGCTCCAGTGCTATCGATTCGATTTTGACTCTCCCATCGATGATCACTCCTACCTGTGGTATGTGGTACGGCGACTTCTCCTGGAATGTTGACAAGCTTCGCGAGGACATCTAATTGCAAGCTCATCCAGGATCAGATCAGCTTCCGCGAGCCAAAGAATGAGCAAATCCGCTTTGGAGTGCCTCAGAGTGCCTCAACATCTCGGAGAACAAGTGTCTGCCAATCAACGGGCTAGT

Full Affymetrix probeset data:

Annotations for 1625354_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720