FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625359_at:

>probe:Drosophila_2:1625359_at:141:173; Interrogation_Position=1066; Antisense; AAAGCATTAGCTCGCGTACGGCGGC
>probe:Drosophila_2:1625359_at:582:213; Interrogation_Position=526; Antisense; AAGAGGCTGTTAGTTCCTGGTGCGC
>probe:Drosophila_2:1625359_at:299:331; Interrogation_Position=558; Antisense; GCGGATCAGCGTGGCATTTTCATAT
>probe:Drosophila_2:1625359_at:688:577; Interrogation_Position=637; Antisense; GGCCGCCTGTCACGAGAGAATCCAA
>probe:Drosophila_2:1625359_at:692:203; Interrogation_Position=681; Antisense; AAGCGGTTACACAATCGCCGTAAGT
>probe:Drosophila_2:1625359_at:705:215; Interrogation_Position=702; Antisense; AAGTTCCGCGCCCAAACACATGTAT
>probe:Drosophila_2:1625359_at:643:59; Interrogation_Position=721; Antisense; ATGTATTCCATCACGCAACCAGCGG
>probe:Drosophila_2:1625359_at:593:663; Interrogation_Position=831; Antisense; TAAATTAACATTTCCCGCCGACGAT
>probe:Drosophila_2:1625359_at:360:461; Interrogation_Position=853; Antisense; GATTATCCTAATTGCGAGCTGGCCT
>probe:Drosophila_2:1625359_at:522:337; Interrogation_Position=888; Antisense; GCTCGTCCTGGCCAAAGATGTTGAA
>probe:Drosophila_2:1625359_at:525:99; Interrogation_Position=903; Antisense; AGATGTTGAATATGCGCCGCTTTCC
>probe:Drosophila_2:1625359_at:626:303; Interrogation_Position=919; Antisense; CCGCTTTCCATTCACTATTTACATT
>probe:Drosophila_2:1625359_at:351:151; Interrogation_Position=939; Antisense; ACATTCATGTCGGTGACACGCGGCA
>probe:Drosophila_2:1625359_at:223:135; Interrogation_Position=956; Antisense; ACGCGGCACGCGAGATTCTGCTAAA

Paste this into a BLAST search page for me
AAAGCATTAGCTCGCGTACGGCGGCAAGAGGCTGTTAGTTCCTGGTGCGCGCGGATCAGCGTGGCATTTTCATATGGCCGCCTGTCACGAGAGAATCCAAAAGCGGTTACACAATCGCCGTAAGTAAGTTCCGCGCCCAAACACATGTATATGTATTCCATCACGCAACCAGCGGTAAATTAACATTTCCCGCCGACGATGATTATCCTAATTGCGAGCTGGCCTGCTCGTCCTGGCCAAAGATGTTGAAAGATGTTGAATATGCGCCGCTTTCCCCGCTTTCCATTCACTATTTACATTACATTCATGTCGGTGACACGCGGCAACGCGGCACGCGAGATTCTGCTAAA

Full Affymetrix probeset data:

Annotations for 1625359_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720