FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625360_at:

>probe:Drosophila_2:1625360_at:697:249; Interrogation_Position=120; Antisense; CAATGAGTCTGAATGTGCGGCCCCA
>probe:Drosophila_2:1625360_at:65:509; Interrogation_Position=134; Antisense; GTGCGGCCCCACATTTAGAGTATAT
>probe:Drosophila_2:1625360_at:644:447; Interrogation_Position=174; Antisense; GATCCATCCACTATACAGAACAGCC
>probe:Drosophila_2:1625360_at:182:27; Interrogation_Position=211; Antisense; ATAGCGCTGGCAAAACTCAATCGAT
>probe:Drosophila_2:1625360_at:461:139; Interrogation_Position=258; Antisense; ACGTCCGATTTGCTTGATGCTGAAT
>probe:Drosophila_2:1625360_at:542:535; Interrogation_Position=337; Antisense; GGTGCCACCAATGCATCCGAAGTGA
>probe:Drosophila_2:1625360_at:270:333; Interrogation_Position=369; Antisense; GCTGCAACTGACAAGAATTCCCCAA
>probe:Drosophila_2:1625360_at:717:165; Interrogation_Position=392; Antisense; AAATCGATCGATTCACCTGTCGCTA
>probe:Drosophila_2:1625360_at:51:307; Interrogation_Position=407; Antisense; CCTGTCGCTACTGGTTTGGATACAT
>probe:Drosophila_2:1625360_at:624:541; Interrogation_Position=432; Antisense; GGTTGATCGTACTCACATTTGTGCG
>probe:Drosophila_2:1625360_at:729:235; Interrogation_Position=528; Antisense; CGCCAAGCGTTTCTTTCAATTCGGA
>probe:Drosophila_2:1625360_at:159:11; Interrogation_Position=546; Antisense; ATTCGGAATCGTTAGCCATCTTCGG
>probe:Drosophila_2:1625360_at:147:567; Interrogation_Position=569; Antisense; GGCAACCATTTCACGGTGTTTCTGT
>probe:Drosophila_2:1625360_at:440:709; Interrogation_Position=607; Antisense; TTAAGCTACTCGAATTGGATCCATC

Paste this into a BLAST search page for me
CAATGAGTCTGAATGTGCGGCCCCAGTGCGGCCCCACATTTAGAGTATATGATCCATCCACTATACAGAACAGCCATAGCGCTGGCAAAACTCAATCGATACGTCCGATTTGCTTGATGCTGAATGGTGCCACCAATGCATCCGAAGTGAGCTGCAACTGACAAGAATTCCCCAAAAATCGATCGATTCACCTGTCGCTACCTGTCGCTACTGGTTTGGATACATGGTTGATCGTACTCACATTTGTGCGCGCCAAGCGTTTCTTTCAATTCGGAATTCGGAATCGTTAGCCATCTTCGGGGCAACCATTTCACGGTGTTTCTGTTTAAGCTACTCGAATTGGATCCATC

Full Affymetrix probeset data:

Annotations for 1625360_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720