FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625361_at:

>probe:Drosophila_2:1625361_at:266:13; Interrogation_Position=103; Antisense; ATTACGGCCATGTCTTTGGGCTCCT
>probe:Drosophila_2:1625361_at:275:525; Interrogation_Position=120; Antisense; GGGCTCCTGCTTGGACTTGGAAGAT
>probe:Drosophila_2:1625361_at:603:59; Interrogation_Position=13; Antisense; ATGTCGGTGGGATGGGCACTCACCT
>probe:Drosophila_2:1625361_at:310:373; Interrogation_Position=174; Antisense; GAAGTCGAGTTGCACACGGTCGCAT
>probe:Drosophila_2:1625361_at:309:161; Interrogation_Position=215; Antisense; ACAAGTCACAGCCAGAGTCCTTTTC
>probe:Drosophila_2:1625361_at:331:87; Interrogation_Position=230; Antisense; AGTCCTTTTCGCCAACCAGCCAGAT
>probe:Drosophila_2:1625361_at:29:317; Interrogation_Position=283; Antisense; GCCTTTCGCTTTTGGCACACAATGA
>probe:Drosophila_2:1625361_at:146:145; Interrogation_Position=30; Antisense; ACTCACCTGGTGTCATAACTGCCAA
>probe:Drosophila_2:1625361_at:533:231; Interrogation_Position=322; Antisense; AATGCAAAACTGGACGCCACAGAAC
>probe:Drosophila_2:1625361_at:36:311; Interrogation_Position=337; Antisense; GCCACAGAACTTTTCGCCAATTGTT
>probe:Drosophila_2:1625361_at:296:241; Interrogation_Position=355; Antisense; AATTGTTCGTCCTCGTTGTCGGCCT
>probe:Drosophila_2:1625361_at:678:635; Interrogation_Position=432; Antisense; TCGACGTGGCTGCACCTACAACTTC
>probe:Drosophila_2:1625361_at:48:331; Interrogation_Position=75; Antisense; GCGGTGCTCCGTACGGCAGACTGCA
>probe:Drosophila_2:1625361_at:668:263; Interrogation_Position=91; Antisense; CAGACTGCAGTTATTACGGCCATGT

Paste this into a BLAST search page for me
ATTACGGCCATGTCTTTGGGCTCCTGGGCTCCTGCTTGGACTTGGAAGATATGTCGGTGGGATGGGCACTCACCTGAAGTCGAGTTGCACACGGTCGCATACAAGTCACAGCCAGAGTCCTTTTCAGTCCTTTTCGCCAACCAGCCAGATGCCTTTCGCTTTTGGCACACAATGAACTCACCTGGTGTCATAACTGCCAAAATGCAAAACTGGACGCCACAGAACGCCACAGAACTTTTCGCCAATTGTTAATTGTTCGTCCTCGTTGTCGGCCTTCGACGTGGCTGCACCTACAACTTCGCGGTGCTCCGTACGGCAGACTGCACAGACTGCAGTTATTACGGCCATGT

Full Affymetrix probeset data:

Annotations for 1625361_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720