FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625362_at:

>probe:Drosophila_2:1625362_at:47:153; Interrogation_Position=2850; Antisense; ACATGAGGATCCACGTGCCGTAGGA
>probe:Drosophila_2:1625362_at:42:25; Interrogation_Position=2891; Antisense; ATATCCTCCAGGAAGTCACCATGCT
>probe:Drosophila_2:1625362_at:467:129; Interrogation_Position=2908; Antisense; ACCATGCTCTCGTCATCGTTTCGAT
>probe:Drosophila_2:1625362_at:61:43; Interrogation_Position=2922; Antisense; ATCGTTTCGATGGAACTTCGAGTTC
>probe:Drosophila_2:1625362_at:201:429; Interrogation_Position=2941; Antisense; GAGTTCCTCGAACCGTCGATCGCAG
>probe:Drosophila_2:1625362_at:303:451; Interrogation_Position=2958; Antisense; GATCGCAGCCGATTTGCCATAGTTA
>probe:Drosophila_2:1625362_at:221:175; Interrogation_Position=3001; Antisense; AAACCAACTATATACCAGCGTCAAG
>probe:Drosophila_2:1625362_at:260:383; Interrogation_Position=3025; Antisense; GAACTACAACGGCAACATAAATCTC
>probe:Drosophila_2:1625362_at:524:165; Interrogation_Position=3043; Antisense; AAATCTCAACTAAGTGCCGTTCCAC
>probe:Drosophila_2:1625362_at:622:315; Interrogation_Position=3058; Antisense; GCCGTTCCACGAGACCTACAAAAAT
>probe:Drosophila_2:1625362_at:501:219; Interrogation_Position=3274; Antisense; AAGTGGCCTGCTGTTATTAAACTAG
>probe:Drosophila_2:1625362_at:296:691; Interrogation_Position=3350; Antisense; TATTGTGTATGTGATTGTTTCCCCA
>probe:Drosophila_2:1625362_at:587:465; Interrogation_Position=3362; Antisense; GATTGTTTCCCCATTATGATACGAT
>probe:Drosophila_2:1625362_at:132:139; Interrogation_Position=3382; Antisense; ACGATTATGATTTATTGTGACCACA

Paste this into a BLAST search page for me
ACATGAGGATCCACGTGCCGTAGGAATATCCTCCAGGAAGTCACCATGCTACCATGCTCTCGTCATCGTTTCGATATCGTTTCGATGGAACTTCGAGTTCGAGTTCCTCGAACCGTCGATCGCAGGATCGCAGCCGATTTGCCATAGTTAAAACCAACTATATACCAGCGTCAAGGAACTACAACGGCAACATAAATCTCAAATCTCAACTAAGTGCCGTTCCACGCCGTTCCACGAGACCTACAAAAATAAGTGGCCTGCTGTTATTAAACTAGTATTGTGTATGTGATTGTTTCCCCAGATTGTTTCCCCATTATGATACGATACGATTATGATTTATTGTGACCACA

Full Affymetrix probeset data:

Annotations for 1625362_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720