FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625363_at:

>probe:Drosophila_2:1625363_at:335:575; Interrogation_Position=111; Antisense; GGCGGGCATCACAGCACAAGATGTT
>probe:Drosophila_2:1625363_at:438:603; Interrogation_Position=132; Antisense; TGTTGCGAATCGTCATGAGACCGAC
>probe:Drosophila_2:1625363_at:342:345; Interrogation_Position=15; Antisense; GCATTTTTTCACCTGCTGTGCATTA
>probe:Drosophila_2:1625363_at:698:303; Interrogation_Position=160; Antisense; CCTGGCCATAGTGTCAAGTGCTTTT
>probe:Drosophila_2:1625363_at:395:495; Interrogation_Position=177; Antisense; GTGCTTTTTCCGCTGTTTTCTAGAA
>probe:Drosophila_2:1625363_at:376:453; Interrogation_Position=228; Antisense; GATAATACCCGGTGCTTTTGACCGA
>probe:Drosophila_2:1625363_at:668:341; Interrogation_Position=241; Antisense; GCTTTTGACCGAGTTCTAGGCCATA
>probe:Drosophila_2:1625363_at:667:677; Interrogation_Position=257; Antisense; TAGGCCATATAGTTACCGCGGAAGC
>probe:Drosophila_2:1625363_at:542:213; Interrogation_Position=316; Antisense; AAGAGCGAGACATCCCATGACGAGT
>probe:Drosophila_2:1625363_at:289:431; Interrogation_Position=337; Antisense; GAGTCTTGTGAATTCGCCTGGCAAA
>probe:Drosophila_2:1625363_at:8:585; Interrogation_Position=355; Antisense; TGGCAAATCTCCGAGTGCTACGAAG
>probe:Drosophila_2:1625363_at:515:475; Interrogation_Position=42; Antisense; GTTAGTCGTCGTTACATTACCAACA
>probe:Drosophila_2:1625363_at:564:599; Interrogation_Position=67; Antisense; TGTTTCGTACAAGCAGGTCCCATTA
>probe:Drosophila_2:1625363_at:685:709; Interrogation_Position=89; Antisense; TTAAGGATCAATGCATGGCGGCGGC

Paste this into a BLAST search page for me
GGCGGGCATCACAGCACAAGATGTTTGTTGCGAATCGTCATGAGACCGACGCATTTTTTCACCTGCTGTGCATTACCTGGCCATAGTGTCAAGTGCTTTTGTGCTTTTTCCGCTGTTTTCTAGAAGATAATACCCGGTGCTTTTGACCGAGCTTTTGACCGAGTTCTAGGCCATATAGGCCATATAGTTACCGCGGAAGCAAGAGCGAGACATCCCATGACGAGTGAGTCTTGTGAATTCGCCTGGCAAATGGCAAATCTCCGAGTGCTACGAAGGTTAGTCGTCGTTACATTACCAACATGTTTCGTACAAGCAGGTCCCATTATTAAGGATCAATGCATGGCGGCGGC

Full Affymetrix probeset data:

Annotations for 1625363_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720