Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625364_at:

>probe:Drosophila_2:1625364_at:684:557; Interrogation_Position=1017; Antisense; GGACATGTGCTTTCCTAGCTTATAA
>probe:Drosophila_2:1625364_at:572:111; Interrogation_Position=509; Antisense; AGCACGAGCGCCATATTTACTTCAT
>probe:Drosophila_2:1625364_at:660:395; Interrogation_Position=550; Antisense; GAAATTCTAGCCTACGACATCCTGG
>probe:Drosophila_2:1625364_at:658:353; Interrogation_Position=585; Antisense; GCACCGCCTATCCTTGGAGAGCAAT
>probe:Drosophila_2:1625364_at:115:615; Interrogation_Position=623; Antisense; TGAATCAATCGTTTCCCATCAAGCC
>probe:Drosophila_2:1625364_at:133:205; Interrogation_Position=643; Antisense; AAGCCAGTGGATTTCATCTTCGGAA
>probe:Drosophila_2:1625364_at:713:645; Interrogation_Position=680; Antisense; TCATACTCTCCGACCAGGATGGTGA
>probe:Drosophila_2:1625364_at:286:157; Interrogation_Position=787; Antisense; ACACATTTGGGCAGTCTTCTGGGCA
>probe:Drosophila_2:1625364_at:232:353; Interrogation_Position=809; Antisense; GCAGCAGTCGCAGCATGATCATCGA
>probe:Drosophila_2:1625364_at:610:475; Interrogation_Position=856; Antisense; GTTATCCCCAAATTCGGAGCTGTCG
>probe:Drosophila_2:1625364_at:677:333; Interrogation_Position=874; Antisense; GCTGTCGTACGATGTGCCAAACTAG
>probe:Drosophila_2:1625364_at:315:179; Interrogation_Position=892; Antisense; AAACTAGCCAACATCACAGCCGAGG
>probe:Drosophila_2:1625364_at:661:15; Interrogation_Position=958; Antisense; ATTTTCTTCACCTCCAATGATGCAT
>probe:Drosophila_2:1625364_at:722:695; Interrogation_Position=982; Antisense; TTATGGGTCCTAAGTGATCGGGTCT

Paste this into a BLAST search page for me
GGACATGTGCTTTCCTAGCTTATAAAGCACGAGCGCCATATTTACTTCATGAAATTCTAGCCTACGACATCCTGGGCACCGCCTATCCTTGGAGAGCAATTGAATCAATCGTTTCCCATCAAGCCAAGCCAGTGGATTTCATCTTCGGAATCATACTCTCCGACCAGGATGGTGAACACATTTGGGCAGTCTTCTGGGCAGCAGCAGTCGCAGCATGATCATCGAGTTATCCCCAAATTCGGAGCTGTCGGCTGTCGTACGATGTGCCAAACTAGAAACTAGCCAACATCACAGCCGAGGATTTTCTTCACCTCCAATGATGCATTTATGGGTCCTAAGTGATCGGGTCT

Full Affymetrix probeset data:

Annotations for 1625364_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime