FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625365_at:

>probe:Drosophila_2:1625365_at:26:589; Interrogation_Position=1300; Antisense; TGGAGCACGTCTATCTGCACCTGAA
>probe:Drosophila_2:1625365_at:47:709; Interrogation_Position=1339; Antisense; TTAAGCCCGCTCTGGACTCTGAGGA
>probe:Drosophila_2:1625365_at:580:381; Interrogation_Position=1404; Antisense; GAACCCTGTAGCCAAGTTGGTCCTG
>probe:Drosophila_2:1625365_at:163:197; Interrogation_Position=1446; Antisense; AACGGCTCGGGTGACGGTCCATCGA
>probe:Drosophila_2:1625365_at:186:225; Interrogation_Position=1515; Antisense; AAGGAGCTGATCTCCCGACTGGTGG
>probe:Drosophila_2:1625365_at:243:43; Interrogation_Position=1569; Antisense; ATCGAGCTCAGCATGGCCATTGATC
>probe:Drosophila_2:1625365_at:436:577; Interrogation_Position=1583; Antisense; GGCCATTGATCAGCGAATAACCATT
>probe:Drosophila_2:1625365_at:719:89; Interrogation_Position=1627; Antisense; AGTACCTAAGCAAGTCCAAGTTCAT
>probe:Drosophila_2:1625365_at:335:137; Interrogation_Position=1696; Antisense; ACGAGCAAGTGGTGTCCCCGGATAA
>probe:Drosophila_2:1625365_at:472:633; Interrogation_Position=1727; Antisense; TCCCCTGGAGGCAGCATCGGAAATT
>probe:Drosophila_2:1625365_at:637:385; Interrogation_Position=1756; Antisense; GAAAATTCCTTACTTCCAGTCACAT
>probe:Drosophila_2:1625365_at:524:89; Interrogation_Position=1773; Antisense; AGTCACATCATGGATCTGCTGTCCC
>probe:Drosophila_2:1625365_at:639:107; Interrogation_Position=1831; Antisense; AGAACTGGGTCTTTATTCCGTCGCA
>probe:Drosophila_2:1625365_at:705:717; Interrogation_Position=1846; Antisense; TTCCGTCGCAGTACTACGAACGCAA

Paste this into a BLAST search page for me
TGGAGCACGTCTATCTGCACCTGAATTAAGCCCGCTCTGGACTCTGAGGAGAACCCTGTAGCCAAGTTGGTCCTGAACGGCTCGGGTGACGGTCCATCGAAAGGAGCTGATCTCCCGACTGGTGGATCGAGCTCAGCATGGCCATTGATCGGCCATTGATCAGCGAATAACCATTAGTACCTAAGCAAGTCCAAGTTCATACGAGCAAGTGGTGTCCCCGGATAATCCCCTGGAGGCAGCATCGGAAATTGAAAATTCCTTACTTCCAGTCACATAGTCACATCATGGATCTGCTGTCCCAGAACTGGGTCTTTATTCCGTCGCATTCCGTCGCAGTACTACGAACGCAA

Full Affymetrix probeset data:

Annotations for 1625365_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720