FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625366_at:

>probe:Drosophila_2:1625366_at:149:61; Interrogation_Position=3873; Antisense; ATGTAGCATTATCTTTTCTCGCCGG
>probe:Drosophila_2:1625366_at:479:697; Interrogation_Position=3887; Antisense; TTTCTCGCCGGAATTCTAAGCTATG
>probe:Drosophila_2:1625366_at:98:281; Interrogation_Position=3902; Antisense; CTAAGCTATGACTTGGGATTCGATA
>probe:Drosophila_2:1625366_at:631:377; Interrogation_Position=3953; Antisense; GAAGCTAGATCTTGACAGTCGCCTT
>probe:Drosophila_2:1625366_at:213:401; Interrogation_Position=3966; Antisense; GACAGTCGCCTTAACTTATGACACG
>probe:Drosophila_2:1625366_at:602:705; Interrogation_Position=3981; Antisense; TTATGACACGCCCATACATCTCAAA
>probe:Drosophila_2:1625366_at:87:31; Interrogation_Position=3994; Antisense; ATACATCTCAAAACGCCCATGCAAA
>probe:Drosophila_2:1625366_at:76:199; Interrogation_Position=4050; Antisense; AACGTATTCAATTCGTCAGTTCAAT
>probe:Drosophila_2:1625366_at:53:475; Interrogation_Position=4068; Antisense; GTTCAATTGTGCTAAGTGTACTTCT
>probe:Drosophila_2:1625366_at:25:537; Interrogation_Position=4104; Antisense; GGTCTAATTATCCTAGTTGTAGCCT
>probe:Drosophila_2:1625366_at:60:131; Interrogation_Position=4163; Antisense; ACCTAGCCCTAGATATACATACATG
>probe:Drosophila_2:1625366_at:187:99; Interrogation_Position=4229; Antisense; AGCGTATTTCGTCTAAGGAGCCCCT
>probe:Drosophila_2:1625366_at:575:653; Interrogation_Position=4242; Antisense; TAAGGAGCCCCTGAAAAGTAAACAT
>probe:Drosophila_2:1625366_at:626:529; Interrogation_Position=4299; Antisense; GGGTATTTTATTAGTGTCGCCAATT

Paste this into a BLAST search page for me
ATGTAGCATTATCTTTTCTCGCCGGTTTCTCGCCGGAATTCTAAGCTATGCTAAGCTATGACTTGGGATTCGATAGAAGCTAGATCTTGACAGTCGCCTTGACAGTCGCCTTAACTTATGACACGTTATGACACGCCCATACATCTCAAAATACATCTCAAAACGCCCATGCAAAAACGTATTCAATTCGTCAGTTCAATGTTCAATTGTGCTAAGTGTACTTCTGGTCTAATTATCCTAGTTGTAGCCTACCTAGCCCTAGATATACATACATGAGCGTATTTCGTCTAAGGAGCCCCTTAAGGAGCCCCTGAAAAGTAAACATGGGTATTTTATTAGTGTCGCCAATT

Full Affymetrix probeset data:

Annotations for 1625366_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720