FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625367_at:

>probe:Drosophila_2:1625367_at:716:133; Interrogation_Position=3301; Antisense; ACGAAATTGAAGCTATACACTGGTA
>probe:Drosophila_2:1625367_at:513:537; Interrogation_Position=3322; Antisense; GGTAGATTTAATTACACTCACATGT
>probe:Drosophila_2:1625367_at:9:709; Interrogation_Position=3366; Antisense; TTACGTGTACGAAAGGCAGATGCGA
>probe:Drosophila_2:1625367_at:321:265; Interrogation_Position=3382; Antisense; CAGATGCGAATTTAAGCGGTGGAAT
>probe:Drosophila_2:1625367_at:40:197; Interrogation_Position=3395; Antisense; AAGCGGTGGAATTTGTACACCTATG
>probe:Drosophila_2:1625367_at:515:665; Interrogation_Position=3410; Antisense; TACACCTATGTACGCGGTAGTTAAT
>probe:Drosophila_2:1625367_at:532:229; Interrogation_Position=3432; Antisense; AATGTGAATACCCAAGCTCCGGACT
>probe:Drosophila_2:1625367_at:292:207; Interrogation_Position=3445; Antisense; AAGCTCCGGACTTAAAATATTGCAA
>probe:Drosophila_2:1625367_at:406:63; Interrogation_Position=3495; Antisense; ATGGGTGGCGAACACACAACATAAT
>probe:Drosophila_2:1625367_at:619:253; Interrogation_Position=3511; Antisense; CAACATAATTATGCAGCGGGTGAAA
>probe:Drosophila_2:1625367_at:571:365; Interrogation_Position=3595; Antisense; GAATCATTATACATTCATGCCTATA
>probe:Drosophila_2:1625367_at:55:395; Interrogation_Position=3652; Antisense; GAAATCCTATGGTTCTAGACAGTTG
>probe:Drosophila_2:1625367_at:245:279; Interrogation_Position=3666; Antisense; CTAGACAGTTGAACAAAGGGCCAAT
>probe:Drosophila_2:1625367_at:445:509; Interrogation_Position=3801; Antisense; GTGCAAATGTACACGCAAAACGCAT

Paste this into a BLAST search page for me
ACGAAATTGAAGCTATACACTGGTAGGTAGATTTAATTACACTCACATGTTTACGTGTACGAAAGGCAGATGCGACAGATGCGAATTTAAGCGGTGGAATAAGCGGTGGAATTTGTACACCTATGTACACCTATGTACGCGGTAGTTAATAATGTGAATACCCAAGCTCCGGACTAAGCTCCGGACTTAAAATATTGCAAATGGGTGGCGAACACACAACATAATCAACATAATTATGCAGCGGGTGAAAGAATCATTATACATTCATGCCTATAGAAATCCTATGGTTCTAGACAGTTGCTAGACAGTTGAACAAAGGGCCAATGTGCAAATGTACACGCAAAACGCAT

Full Affymetrix probeset data:

Annotations for 1625367_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720