FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625369_at:

>probe:Drosophila_2:1625369_at:146:285; Interrogation_Position=1014; Antisense; CTGTGTCGCCGCCTAAAAGTGGAAC
>probe:Drosophila_2:1625369_at:430:413; Interrogation_Position=1064; Antisense; GACCAACAAGGATCGTGTGACCAAT
>probe:Drosophila_2:1625369_at:395:101; Interrogation_Position=1112; Antisense; AGAGCAAATGCTATCCGAGGACACC
>probe:Drosophila_2:1625369_at:172:559; Interrogation_Position=1130; Antisense; GGACACCTCGCGCAACTGGATGAAA
>probe:Drosophila_2:1625369_at:424:443; Interrogation_Position=1148; Antisense; GATGAAACTTTTCGAGGGCGCCTCC
>probe:Drosophila_2:1625369_at:206:11; Interrogation_Position=1197; Antisense; ATTCCCGAGGTCTTCGAGGACGAGC
>probe:Drosophila_2:1625369_at:592:591; Interrogation_Position=1240; Antisense; TGGTGAAAAGCCTGCGGCATCCCAA
>probe:Drosophila_2:1625369_at:168:185; Interrogation_Position=1271; Antisense; AACAGTCAAGGTGGTTGGTCCTCCT
>probe:Drosophila_2:1625369_at:515:379; Interrogation_Position=1308; Antisense; GAAGCGCGAAACGATGCCCGGACAG
>probe:Drosophila_2:1625369_at:396:463; Interrogation_Position=1340; Antisense; GATTCTTGGCCAGCACACGGATGAA
>probe:Drosophila_2:1625369_at:541:67; Interrogation_Position=1364; Antisense; AGTGCTGGGCGAACTACTGGGTTAC
>probe:Drosophila_2:1625369_at:436:273; Interrogation_Position=1424; Antisense; CATTATTCAGTAACCCGATTGGGAT
>probe:Drosophila_2:1625369_at:240:53; Interrogation_Position=1539; Antisense; ATGCATTTACCATTAGACCGACTAA
>probe:Drosophila_2:1625369_at:370:603; Interrogation_Position=998; Antisense; TGTTCAGTTTGTGGACCTGTGTCGC

Paste this into a BLAST search page for me
CTGTGTCGCCGCCTAAAAGTGGAACGACCAACAAGGATCGTGTGACCAATAGAGCAAATGCTATCCGAGGACACCGGACACCTCGCGCAACTGGATGAAAGATGAAACTTTTCGAGGGCGCCTCCATTCCCGAGGTCTTCGAGGACGAGCTGGTGAAAAGCCTGCGGCATCCCAAAACAGTCAAGGTGGTTGGTCCTCCTGAAGCGCGAAACGATGCCCGGACAGGATTCTTGGCCAGCACACGGATGAAAGTGCTGGGCGAACTACTGGGTTACCATTATTCAGTAACCCGATTGGGATATGCATTTACCATTAGACCGACTAATGTTCAGTTTGTGGACCTGTGTCGC

Full Affymetrix probeset data:

Annotations for 1625369_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720